forkhead box N1 (FOXN1) - 1918 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.16318
gtgagctgggggtgggaaagggaaggtgggacaggactggagaggagcacctggcagtgg  c.1627+60

         .         .         .         .         .         .  g.16378
gactcatcttctccaagtctccagactgcagcctgcaagtggctgggtttctggtcaact  c.1627+120

         .         .         .         .         .         .  g.16438
gaagcagaggaggctggacctggcagggggagcttcccacttgctctctgccatccagag  c.1627+180

         .         .         .         .         .         .  g.16498
aatggggaaagagggatgtccttgcccctgtctccctcctcctggtgctccaaacatggt  c.1627+240

         .         .         .         .         .         .  g.16558
ccaactgacctcatcatcaaaccactcttggcagggcacagtggctcacgcctgtaatcc  c.1627+300

         .         .         .         .         .         .  g.16618
cagcactctgggaggctgaggtgggcagatcacctgaggtcaggcattcgagaccagctt  c.1627+360

         .         .         .         .         .         .  g.16678
ggccaacatggagaaacactgtctctatttaaaaatgcaaaaattagctgggcatggtgg  c.1627+420

         .         .         .         .         .         .  g.16738
catgcacctgtaatcccagctactcgaggctagagaatcacttgaacccgggaggcggag  c.1627+480

         .         .         .         .         .         .  g.16798
gttgcagtgagccaagatcgtgccactgcactccagcctgagtgacagagcgagactccg  c.1627+540

         .         .         .         .         .         .  g.16858
cctcaaaaacaaacaaacaaaaaaaccactctcagctctggagagactgcaaagggctcc  c.1627+600

         .         .         .         .         .         .  g.16918
gtgttctattctatactcgattgtgagtgaccagtagtctgaacattctcagatgcattt  c.1627+660

         .         .         .         .         .         .  g.16978
gcattttatcagagttcatcttctaaagcagaaggagagagactctaccctagaggaaga  c.1627+720

         .         .         .         .         .         .  g.17038
gtctcagagctgggcaagtcctggagagatttggagataggagtttggggagggttctac  c.1627+780

         .         .         .         .         .         .  g.17098
ccattccactccatcttggctgctccgtctctgcagatggctaagcccacccattcccgt  c.1627+840

         .         .         .         .         .         .  g.17158
ctaaattccagtgcatcccaggccctgatactggccacaggaggtttggaacggggtgac  c.1627+900

         .         .         .         .         .           g.17217
gacccaggcctcagactctgtgtgcacaggggtgggggacattcacaagctgatggagg  c.1627+959

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.17276
 cagcctgtcctcagagagctcccaacccgatggggagacaacccaggtttaggaagcta  c.1628-901

.         .         .         .         .         .           g.17336
ttagaaaagtgcacatagatcctcagcccagtccagaagtggggagcagggctcaatcag  c.1628-841

.         .         .         .         .         .           g.17396
cctcagaggaagctatagacatgtgggatacgaaaaacatttacttgatcccctgctagg  c.1628-781

.         .         .         .         .         .           g.17456
catcaggcatcaggctggctgctctctatgtgctttctcatctgggcctagaggatagga  c.1628-721

.         .         .         .         .         .           g.17516
aggattattaaacctgcttcatggaagcacacagaggcttgagaacttactctaggtcac  c.1628-661

.         .         .         .         .         .           g.17576
ttagctagaaagagggagagttgggactggaacccaggcagccaaatccaatccagggtt  c.1628-601

.         .         .         .         .         .           g.17636
tagtcaggccctctctctccagagcttgcagcctggatacccagtgcaggagccccaggc  c.1628-541

.         .         .         .         .         .           g.17696
cctggtcagccatgatgagggtccacaggtggcagcactgtttgctcctcggactcaggt  c.1628-481

.         .         .         .         .         .           g.17756
gtgcatcctggctctgctcccattccctgggccctgcagtggaggagacccagggagcca  c.1628-421

.         .         .         .         .         .           g.17816
tgcccatccatcccattaggtccagagtacactgccggaagctgcttgatctgggctgca  c.1628-361

.         .         .         .         .         .           g.17876
aatctaccttccttgggagactgggcatgagccagggttcactcccaagtgcacaacatt  c.1628-301

.         .         .         .         .         .           g.17936
ggcatccatgctgtcagcctgtcagcaggcatcaacccctccccaatgcccaccccccaa  c.1628-241

.         .         .         .         .         .           g.17996
aaagaaccacagaggtcatctagatcgacggctttcagattgtgctacacgggaggagga  c.1628-181

.         .         .         .         .         .           g.18056
atctgaggctgagaggttcagcaactgcctggggtcacaagctagtgccaggctctgttc  c.1628-121

.         .         .         .         .         .           g.18116
ccagcacatgtcaccctgacccctgctctctgcagcatgtgaagattgacagggaggagg  c.1628-61

.         .         .         .         .         .           g.18176
ggccagacagggctcctccggtgcctcccagtgacacctgttctctccttccccatctag  c.1628-1


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center