forkhead box N1 (FOXN1) - upstream reference sequence


   g.1              .         .         .         .             g.49
   c.-5029 gctttcaaaagtaaataaatcataatgtttaaaaaggctctgatttgta    c.-4981

.         .         .         .         .         .             g.109
ggatttgctaatttccatgggcaaatactcccactgtggctgatctccaccaatttcact    c.-4921

.         .         .         .         .         .             g.169
ggatatggagttgggaagaaatgggcacaattggctctcatgagcccttgccaactggct    c.-4861

.         .         .         .         .         .             g.229
ctgcacaccattgccccctaccctctggggcaaagggaggataacatgagacaagagata    c.-4801

.         .         .         .         .         .             g.289
caaaagtgcagaggggctgggcgcggtggtgcacacctgtaatctcagcactttgggagg    c.-4741

.         .         .         .         .         .             g.349
ctaaggcgggaggatcagttgagcccaggaggtcgaggctgcagtgagtgatgattgtgc    c.-4681

.         .         .         .         .         .             g.409
cactgcactccagcctgggcgacagcaagaccttgtctcaaaaaaaaaaaaaagtgcaga    c.-4621

.         .         .         .         .         .             g.469
ggaaacttcagagtgcactgcagatgtggaactgcggcaaagggaccccagggcacagtc    c.-4561

.         .         .         .         .         .             g.529
tgccagtgagagcctcagcctctagtccaggaagcaggtggttgtgggttgtgggtaccc    c.-4501

.         .         .         .         .         .             g.589
atattgaggggcagttcatgagagtgatctggaggagctcccggaatctgagaaggcagg    c.-4441

.         .         .         .         .         .             g.649
agagctgactgggcctcctgtgctggtatttgctgatacttgcacacacatcccatccag    c.-4381

.         .         .         .         .         .             g.709
ttccagtgctccctgaaactggaacaggcaggataaaggttggacctctatgaaagatcc    c.-4321

.         .         .         .         .         .             g.769
cttctgaatgcagatgtcagccccaggacactggggccagcagagagacctcccgagaga    c.-4261

.         .         .         .         .         .             g.829
tccaaaacaagagagtcaacccccctcctctccacataagtcccagaagtttctacagac    c.-4201

.         .         .         .         .         .             g.889
actagctctaccacatgggaaaggcggaaatgacctctgaggccagagagtcaggaagag    c.-4141

.         .         .         .         .         .             g.949
ggaagtttagcctctgccaatgggagaggacaatgtcaaggacctggaggtagaaggtag    c.-4081

.         .         .         .         .         .             g.1009
gagaaggcaggaaaggggagttcccttcctgatgctcccgatccccccacccccataact    c.-4021

.         .         .         .         .         .             g.1069
caggccttaaacaaactctgtcccactgctaattattaataatagctatcatttattgag    c.-3961

.         .         .         .         .         .             g.1129
catgtactatgtgttaagctatttacaagcaatattttattaatcctccagagaggtaag    c.-3901

.         .         .         .         .         .             g.1189
tatttattagtcctattttacagatgaggaaactgaggcatggggaaggaagttaagcat    c.-3841

.         .         .         .         .         .             g.1249
catgcccaaccaaagtcccacagttcctgcgattcaaatccagccctgactccaggtcgt    c.-3781

.         .         .         .         .         .             g.1309
ccagcttcaggggttctgccggctactccagggaagggtcagggccaaggcagcctcatc    c.-3721

.         .         .         .         .         .             g.1369
caggttcctgcagtgagcccttcccagtgatggacaggagcccctcataaacaccagtca    c.-3661

.         .         .         .         .         .             g.1429
gagggcttctgaccagcccctgaggaccccctctctcctgggccgtgtggccttaggaaa    c.-3601

.         .         .         .         .         .             g.1489
gtcactttacctgttccctgggtctcacttgtagaatagagctttagctgcaaccaaggg    c.-3541

.         .         .         .         .         .             g.1549
ggcatcatggtcaccaaatcaggagtccccacttacaaaacctgcccagaggaatcccag    c.-3481

.         .         .         .         .         .             g.1609
aggaccagtcaggaacctctgcatccttaatgcaaattaaggggtgggcctctgaactct    c.-3421

.         .         .         .         .         .             g.1669
gcataacttccttggttctcatcctgtccccgggggattggaggaggtagcagggtggtt    c.-3361

.         .         .         .         .         .             g.1729
tggccaagcaaggctatgaaagtcatggctgtgaactgaagcctctgttaaggcctctga    c.-3301

.         .         .         .         .         .             g.1789
catacaggaacttggctggagctggagatgatgttctggagaatagggaacaggtgcaag    c.-3241

.         .         .         .         .         .             g.1849
aatggggtgaggccgacactgcggggatcattctgggcaggccagaccctcaggaggtgg    c.-3181

.         .         .         .         .         .             g.1909
tgcaggcctgagctggagttcagagaggcctccccaggttcacatctgcaggggagcagt    c.-3121

.         .         .         .         .         .             g.1969
gctggggtctgaggccaggctgagtgaaggccaggcaggcaaggagggctagcaagggca    c.-3061

.         .         .         .         .         .             g.2029
gctgccacctggggctgggtcttcagccaatcgccccaggactgccaggcctgaggcaac    c.-3001

.         .         .         .         .         .             g.2089
gagagcatcagagaagctgtagagcctggggccaaaggcccctgcagccacacttggcca    c.-2941

.         .         .         .         .         .             g.2149
gcagtggccagatgcatgacacatgtcctcgagcattttccctgtgccagcacctcgtgc    c.-2881

.         .         .         .         .         .             g.2209
acaccatcctcacgatgaccctgcgaggtgggtctgtgtgccccatttctcagatgcgga    c.-2821

.         .         .         .         .         .             g.2269
aagtgaggcacagagagctacacagtttgctcaaagtcacacagccagaaagtgacaaag    c.-2761

.         .         .         .         .         .             g.2329
ctggggctggaattcagctgggcttgactccaaatccttgctctaaaacaccgtgctacc    c.-2701

.         .         .         .         .         .             g.2389
ccacctgcagggaggggagtggccaccctccccaggttacaaagcctgagatctggcggg    c.-2641

.         .         .         .         .         .             g.2449
gaagaagggccctcggcctcccatttggagctggagaatgccagccccctgcaccaagcc    c.-2581

.         .         .         .         .         .             g.2509
ccctgcaccacctcctgagaaggcagctctgggccggggtgaggtgtggcctccaggcag    c.-2521

.         .         .         .         .         .             g.2569
gcccgagctctccaggaggagctgtccagggagcaggaggcagtgatgcggagcgggagg    c.-2461

.         .         .         .         .         .             g.2629
tgggctgccccgcacctcgggccccatgcctgctccgctgtggtgtcccgttacggccag    c.-2401

.         .         .         .         .         .             g.2689
ctcggcgcttccctggtcacgccacatttagcattgccgagtgagcaggcgccaggacat    c.-2341

.         .         .         .         .         .             g.2749
caagaaggggtggtggggactcttgaaggggcgggagagcctcccaccaggcccccacct    c.-2281

.         .         .         .         .         .             g.2809
agaccccggcttccagcccctccaccactgatcccctgtgggatctttgggcaaatccta    c.-2221

.         .         .         .         .         .             g.2869
tgggactttgggcaaattgcctcccctcattttccctgttaccctgtctgtcaaatgagg    c.-2161

.         .         .         .         .         .             g.2929
cttattgatggtttattcagcaaagatgtgccaaccccagcctgggtaccacggggccaa    c.-2101

.         .         .         .         .         .             g.2989
tgaggccacctctccctcccagagctccggaaagagcatggcctgggcacagcacagctg    c.-2041

.         .         .         .         .         .             g.3049
ccctgctctggcttgagggggtcttgggtagaaggagtgagtgtacacctcatgcttttc    c.-1981

.         .         .         .         .         .             g.3109
ttgatgcctggcctcccagcctagcctaccccaactttgacacccacccaatgaagaaac    c.-1921

.         .         .         .         .         .             g.3169
cataagcagagtgcagagtctgcagtcggacagaccagagttcttgcccctgggcgactt    c.-1861

.         .         .         .         .         .             g.3229
gggcaagtcacataaccccgctgagcctcagcatcctcatctggaaggtggagtcaataa    c.-1801

.         .         .         .         .         .             g.3289
tgctccttcctctcattgttctaatagatcaatgagaaaaccatccaaattgttcacaca    c.-1741

.         .         .         .         .         .             g.3349
gtggccagcccagagcagaccctcagcaaactgtagcatttatcagaggccacttgggca    c.-1681

.         .         .         .         .         .             g.3409
aagagaagtacatttaagaggaattgctcttgcaggtggtaaaggaaggcaaaaagctga    c.-1621

.         .         .         .         .         .             g.3469
ggatagtaagagtgagaggccgggcacagtggctaggctgtaatcccagcactttgggag    c.-1561

.         .         .         .         .         .             g.3529
gccaaagcaggcagatcatctgaggtcaggagttggagaccagcctggccaaaatagtga    c.-1501

.         .         .         .         .         .             g.3589
aatcccttctctactaaaaatacaaaaattagccaggcatggtggcatgtgcctgtagtc    c.-1441

.         .         .         .         .         .             g.3649
ccagctactcttgaggctgaggcaggaaaatcacttgaactcaggaggtggaggttgaag    c.-1381

.         .         .         .         .         .             g.3709
tgagccgagagcatgccaccgcactccagcctaggcaacagagggagactccgtctccaa    c.-1321

.         .         .         .         .         .             g.3769
aaaaacaaataaataaaaataaaaacaaaaatacaaaaaatagccaggtgtggtggtaca    c.-1261

.         .         .         .         .         .             g.3829
agcctgtagtcccagctactcttgaggctgaggcaggagagttgcttgaacccgggaggc    c.-1201

.         .         .         .         .         .             g.3889
agaggttgcagtaagccaagatgatgccactgcactccagcctgggtgacagagagagac    c.-1141

.         .         .         .         .         .             g.3949
tccatctcaaaaaaaaaaaaaaagtgagaaccacactcacaataatattcataatgagaa    c.-1081

.         .         .         .         .         .             g.4009
ctggcatttatggggcacggactgtgcaccaggcactgtgctgaatgctttctgcgcatg    c.-1021

.         .         .         .         .         .             g.4069
attttgtttgacactcacaacatctgtgtgaggtggggcctgtcactctcccagttagat    c.-961

.         .         .         .         .         .             g.4129
gatgacgctgaagttcagagagctttgctggcactgcttgagaggaagggccaaccccgg    c.-901

.         .         .         .         .         .             g.4189
ctttgaggcctgagtcctcttaaccaccccactgtgttagggacagggttcccctatgat    c.-841

.         .         .         .         .         .             g.4249
tgcagaaggtctgagcagaaaaagccctccgatatcatgtacccaaggctctaggtcttc    c.-781

.         .         .         .         .         .             g.4309
atggggaaactgaagatcagaaaggggcagtggcctgcacaaagtcacaggttagagttt    c.-721

.         .         .         .         .         .             g.4369
ggaggacacaggtggaacagcacttgccaggcgctgcagtgtgggtggtgacatcgtcag    c.-661

.         .         .         .         .         .             g.4429
ggcccgctgggctcacagggcctccaggcaaccgggggcctttgggtccccagttacaca    c.-601

.         .         .         .         .         .             g.4489
ctgtggtcacatcagccaggctgacctgagggtcactgcaggaccagcctctgctgaggg    c.-541

.         .         .         .         .         .             g.4549
ctggctcacctgcatggagggggttgctcccaccccaagcatgagtctgacccacgcacc    c.-481

.         .         .         .         .         .             g.4609
agctcactctcccctcaggaccaccgacttgcccagtcactgaatggagaccacctgctg    c.-421

.         .         .         .         .         .             g.4669
tggtcaccttgccaggcccttctctgtagacacaggagaccgatcttgaggagccagagg    c.-361

.         .         .         .         .         .             g.4729
cagagcccagctgggagccggggtttcactggtcagtcggtcagtctctgcagctgcagc    c.-301

.         .         .         .         .         .             g.4789
ctgagatcagccaagcccctcctgaggctcctacctggctcactttgccctttctccaca    c.-241

.         .         .         .         .         .             g.4849
ggggtctgatctctctgctctgcttttccaaactatttctctttctctctctcgctctct    c.-181

.         .         .         .         .         .             g.4909
ggttctctctctctctctctctctctctctctctctctctctcatcagatggctgactgg    c.-121

.         .         .         .         .         .             g.4969
aggcagggtcccagcccaaggatggggttggggtggaggtggcgaacctgggttggtccc    c.-61

.         .         .         .            .         .          g.5029
cactggatgctggtcctcactctcatggcag \ acggctttctttgaggccaggactgggtg c.-1


Powered by LOVD v.3.0 Build 20c
©2004-2018 Leiden University Medical Center