ferritin, heavy polypeptide 1 (FTH1) - coding DNA reference sequence

(used for variant description)

(last modified November 25, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_002032.2 in the FTH1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008346.1, covering FTH1 transcript NM_002032.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5055
      ataagagaccacaagcgacccgcagggccagacgttcttcgccgagagtcgtcgg       c.-181

 .         .         .         .         .         .                g.5115
 ggtttcctgcttcaacagtgcttggacggaacccggcgctcgttccccaccccggccggc       c.-121

 .         .         .         .         .         .                g.5175
 cgcccatagccagccctccgtcacctcttcaccgcaccctcggactgccccaaggccccc       c.-61

 .         .         .         .         .         .                g.5235
 gccgccgctccagcgccgcgcagccaccgccgccgccgccgcctctccttagtcgccgcc       c.-1

          .         .         .         .         .         .       g.5295
 ATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCC       c.60
 M  T  T  A  S  T  S  Q  V  R  Q  N  Y  H  Q  D  S  E  A  A         p.20

          .         .         .         .         .     | 02   .    g.7151
 ATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATG | TCTTAC    c.120
 I  N  R  Q  I  N  L  E  L  Y  A  S  Y  V  Y  L  S  M   | S  Y      p.40

          .         .         .         .         .         .       g.7211
 TACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCT       c.180
 Y  F  D  R  D  D  V  A  L  K  N  F  A  K  Y  F  L  H  Q  S         p.60

          .         .         .         .         .         .       g.7271
 CATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGA       c.240
 H  E  E  R  E  H  A  E  K  L  M  K  L  Q  N  Q  R  G  G  R         p.80

          .         .  | 03      .         .         .         .    g.7587
 ATCTTCCTTCAGGATATCAAG | AAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCA    c.300
 I  F  L  Q  D  I  K   | K  P  D  C  D  D  W  E  S  G  L  N  A      p.100

          .         .         .         .         .         .       g.7647
 ATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAA       c.360
 M  E  C  A  L  H  L  E  K  N  V  N  Q  S  L  L  E  L  H  K         p.120

          .         .        | 04.         .         .         .    g.7802
 CTGGCCACTGACAAAAATGACCCCCAT | TTGTGTGACTTCATTGAGACACATTACCTGAAT    c.420
 L  A  T  D  K  N  D  P  H   | L  C  D  F  I  E  T  H  Y  L  N      p.140

          .         .         .         .         .         .       g.7862
 GAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGA       c.480
 E  Q  V  K  A  I  K  E  L  G  D  H  V  T  N  L  R  K  M  G         p.160

          .         .         .         .         .         .       g.7922
 GCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGAT       c.540
 A  P  E  S  G  L  A  E  Y  L  F  D  K  H  T  L  G  D  S  D         p.180

          .                                                         g.7934
 AATGAAAGCTAA                                                       c.552
 N  E  S  X                                                         p.183

          .         .         .         .         .         .       g.7994
 gcctcgggctaatttccccatagccgtggggtgacttccctggtcaccaaggcagtgcat       c.*60

          .         .         .         .         .         .       g.8054
 gcatgttggggtttcctttaccttttctataagttgtaccaaaacatccacttaagttct       c.*120

          .         .         .         .         .         .       g.8114
 ttgatttgtaccattccttcaaataaagaaatttggtacccaggtgttgtctttgaggtc       c.*180

          .         .         .         .         .         .       g.8174
 ttgggatgaatcagaaatctatccaggctatcttccagattccttaagtgccgttgttca       c.*240

          .         .         .         .         .         .       g.8234
 gttctaatcacactaatcaaaaagaaacgagtatttgtatttattaaactcattagtttg       c.*300

          .         .         .         .         .         .       g.8294
 ggcagtatactaaggtgtggctgtcttggattcagatagaactaagggttcccgactctg       c.*360

          .         .         .         .         .         .       g.8354
 aatccagagtctgagttaaatgtttccaatggttcagtctagctttcacagtttttatga       c.*420

          .         .                                               g.8376
 ataaaaggcattaaaggctgaa                                             c.*442

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ferritin, heavy polypeptide 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.