ferritin, light polypeptide (FTL) - coding DNA reference sequence

(used for variant description)

(last modified November 30, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_000146.3 in the FTL gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008152.1, covering FTL transcript NM_000146.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5019
                                          gcagttcggcggtcccgcg       c.-181

 .         .         .         .         .         .                g.5079
 ggtctgtctcttgcttcaacagtgtttggacggaacagatccggggactctcttccagcc       c.-121

 .         .         .         .         .         .                g.5139
 tccgaccgccctccgatttcctctccgcttgcaacctccgggaccatcttctcggccatc       c.-61

 .         .         .         .         .         .                g.5199
 tcctgcttctgggacctgccagcaccgtttttgtggttagctccttcttgccaaccaacc       c.-1

          .         .         .         .         .         .       g.5259
 ATGAGCTCCCAGATTCGTCAGAATTATTCCACCGACGTGGAGGCAGCCGTCAACAGCCTG       c.60
 M  S  S  Q  I  R  Q  N  Y  S  T  D  V  E  A  A  V  N  S  L         p.20

          .         .         .         .   | 02     .         .    g.5479
 GTCAATTTGTACCTGCAGGCCTCCTACACCTACCTCTCTCTG | GGCTTCTATTTCGACCGC    c.120
 V  N  L  Y  L  Q  A  S  Y  T  Y  L  S  L   | G  F  Y  F  D  R      p.40

          .         .         .         .         .         .       g.5539
 GATGATGTGGCTCTGGAAGGCGTGAGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGC       c.180
 D  D  V  A  L  E  G  V  S  H  F  F  R  E  L  A  E  E  K  R         p.60

          .         .         .         .         .         .       g.5599
 GAGGGCTACGAGCGTCTCCTGAAGATGCAAAACCAGCGTGGCGGCCGCGCTCTCTTCCAG       c.240
 E  G  Y  E  R  L  L  K  M  Q  N  Q  R  G  G  R  A  L  F  Q         p.80

           | 03        .         .         .         .         .    g.6023
 GACATCAAG | AAGCCAGCTGAAGATGAGTGGGGTAAAACCCCAGACGCCATGAAAGCTGCC    c.300
 D  I  K   | K  P  A  E  D  E  W  G  K  T  P  D  A  M  K  A  A      p.100

          .         .         .         .         .         .       g.6083
 ATGGCCCTGGAGAAAAAGCTGAACCAGGCCCTTTTGGATCTTCATGCCCTGGGTTCTGCC       c.360
 M  A  L  E  K  K  L  N  Q  A  L  L  D  L  H  A  L  G  S  A         p.120

          .      | 04  .         .         .         .         .    g.6319
 CGCACGGACCCCCAT | CTCTGTGACTTCCTGGAGACTCACTTCCTAGATGAGGAAGTGAAG    c.420
 R  T  D  P  H   | L  C  D  F  L  E  T  H  F  L  D  E  E  V  K      p.140

          .         .         .         .         .         .       g.6379
 CTTATCAAGAAGATGGGTGACCACCTGACCAACCTCCACAGGCTGGGTGGCCCGGAGGCT       c.480
 L  I  K  K  M  G  D  H  L  T  N  L  H  R  L  G  G  P  E  A         p.160

          .         .         .         .                           g.6427
 GGGCTGGGCGAGTATCTCTTCGAAAGGCTCACTCTCAAGCACGACTAA                   c.528
 G  L  G  E  Y  L  F  E  R  L  T  L  K  H  D  X                     p.175

          .         .         .         .         .         .       g.6487
 gagccttctgagcccagcgacttctgaagggccccttgcaaagtaatagggcttctgcct       c.*60

          .         .         .         .         .         .       g.6547
 aagcctctccctccagccaataggcagctttcttaactatcctaacaagccttggaccaa       c.*120

          .         .                                               g.6571
 atggaaataaagctttttgatgca                                           c.*144

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ferritin, light polypeptide protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.