glycine cleavage system protein H (aminomethyl carrier) (GCSH) - coding DNA reference sequence

(used for variant description)

(last modified August 30, 2012)

This file was created to facilitate the description of sequence variants on transcript NM_004483.4 in the GCSH gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering GCSH transcript NM_004483.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5037
                        cagccggctccctccggccgcgaactgcccctccccg       c.-61

 .         .         .         .         .         .                g.5097
 ccccgcctcccggcgcgggtggccgaggcgtagcgctgcgacccccgcacccctgcgaac       c.-1

          .         .         .         .         .         .       g.5157
 ATGGCGCTGCGAGTGGTGCGGAGCGTGCGGGCCCTGCTCTGCACCCTGCGCGCGGTCCCG       c.60
 M  A  L  R  V  V  R  S  V  R  A  L  L  C  T  L  R  A  V  P         p.20

          .         .         .         .         .         .       g.5217
 TCACCCGCCGCGCCCTGCCCGCCGAGGCCCTGGCAGCTGGGGGTGGGCGCCGTCCGTACG       c.120
 S  P  A  A  P  C  P  P  R  P  W  Q  L  G  V  G  A  V  R  T         p.40

          .         .         | 02         .         .         .    g.10727
 CTGCGCACTGGACCCGCTCTGCTCTCGG | TGCGTAAATTCACAGAGAAACACGAATGGGTA    c.180
 L  R  T  G  P  A  L  L  S  V |   R  K  F  T  E  K  H  E  W  V      p.60

          .         .         .         .         | 03         .    g.13723
 ACAACAGAAAATGGCATTGGAACAGTGGGAATCAGCAATTTTGCACAG | GAAGCGTTGGGA    c.240
 T  T  E  N  G  I  G  T  V  G  I  S  N  F  A  Q   | E  A  L  G      p.80

          .         .         .         .         .   | 04     .    g.16789
 GATGTTGTTTATTGTAGTCTCCCTGAAGTTGGGACAAAATTGAACAAACAAG | ATGAGTTT    c.300
 D  V  V  Y  C  S  L  P  E  V  G  T  K  L  N  K  Q  D |   E  F      p.100

          .         .         .         .         .         .       g.16849
 GGTGCTTTGGAAAGTGTGAAAGCTGCTAGTGAACTCTATTCTCCTTTATCAGGAGAAGTA       c.360
 G  A  L  E  S  V  K  A  A  S  E  L  Y  S  P  L  S  G  E  V         p.120

          .         .         .         .         .         .       g.16909
 ACTGAAATTAATGAAGCTCTTGCAGAAAATCCAGGACTTGTAAACAAATCTTGTTATGAA       c.420
 T  E  I  N  E  A  L  A  E  N  P  G  L  V  N  K  S  C  Y  E         p.140

      | 05   .         .         .         .         .         .    g.18468
 GATG | GTTGGCTGATCAAGATGACACTGAGTAACCCTTCAGAACTAGATGAACTTATGAGT    c.480
 D  G |   W  L  I  K  M  T  L  S  N  P  S  E  L  D  E  L  M  S      p.160

          .         .         .         .                           g.18510
 GAAGAAGCATATGAGAAATACATAAAATCTATTGAGGAGTGA                         c.522
 E  E  A  Y  E  K  Y  I  K  S  I  E  E  X                           p.173

          .         .         .         .         .         .       g.18570
 aaatggaactcctaaataaactagtatgaaataacgcaagccagcagagttgtcttaaat       c.*60

          .         .         .         .         .         .       g.18630
 tagtggtggatagaagacttagaatagaaacttttagtattaccgatggggaaaaaaaaa       c.*120

          .         .         .         .         .         .       g.18690
 ctactgttaacactgctaatgaaagaaaatgccctttaactttctaatgattatagataa       c.*180

          .         .         .         .         .         .       g.18750
 atataatatgcgtctttttcacaatatcctatgatttttagactaggctctagtgttcag       c.*240

          .         .         .         .         .         .       g.18810
 aattcatgaaattatccatggtaaaaactagttataaaaattacataattcaaagataac       c.*300

          .         .         .         .         .         .       g.18870
 attgttattcttaagccttatataatattgtaacttgcatgtatccatacctggatttgg       c.*360

          .         .         .         .         .         .       g.18930
 gatgaaatacttaatgatctttccattggaaataactggaagtgaagaggttttgttgct       c.*420

          .         .         .         .         .         .       g.18990
 tgtacagtgtcagatgaggaacaccactatcttaattttgcgatacactgcatttgctgg       c.*480

          .         .         .         .         .         .       g.19050
 tgctatttttatacagtgaagcaacagctttgcagcaaaataataaaatacttcttcgtt       c.*540

          .         .         .         .         .         .       g.19110
 aatcatgtttgttttgatgttaatatttcatttagtaactctgctagtatttgtgaaagt       c.*600

          .         .         .         .         .         .       g.19170
 gctaactttaacttacggaaagttactttttaaaaggaaatttaagccagaacaatgcaa       c.*660

          .         .         .         .         .         .       g.19230
 agctccaagaaaatgttttctttagtcacaaatctggtttttcttaagccaagatctgtc       c.*720

          .         .         .         .         .         .       g.19290
 acctttaacataataaaaaataaatcaccaactttgattttctatcatgcgaggtctgaa       c.*780

          .         .         .         .         .         .       g.19350
 gaaagaagaggaaagacagaggaaggtggaagttttgatcagtatagcacatggtgtttt       c.*840

          .         .         .         .         .         .       g.19410
 taagttgttaaaccacgttcaggtttccacttaagtcatgggaataaaagtggacaagga       c.*900

          .                                                         g.19429
 ctgaagctttatgagctca                                                c.*919

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Glycine cleavage system protein H (aminomethyl carrier) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.