glial cell derived neurotrophic factor (GDNF) - coding DNA reference sequence

(used for variant description)

(last modified October 16, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_000514.3 in the GDNF gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011675.2, covering GDNF transcript NM_000514.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5020
                                         ccgcctccagcgcgcccttg       c.-181

 .         .         .         .         .         .                g.5080
 ctgccccgcgcgaccccaggattgcgaactcttgcccctgacctgttgggcggggctccg       c.-121

 .         .         .         .         .         .                g.5140
 cgctccagccatcagcccggatgggtctcctggctgggacttggggcacctggagttaat       c.-61

 .         .         .         .    | 02    .         .             g.9884
 gtccaacctagggtctgcggagacccgatccgag | gtgccgccgccggacgggactttaag    c.-1

          .         .         .         .         .         .       g.9944
 ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGCCTTC       c.60
 M  K  L  W  D  V  V  A  V  C  L  V  L  L  H  T  A  S  A  F         p.20

          .         .         .         .         .         .       g.10004
 CCGCTGCCCGCCGGTAAGAGGCCTCCCGAGGCGCCCGCCGAAGACCGCTCCCTCGGCCGC       c.120
 P  L  P  A  G  K  R  P  P  E  A  P  A  E  D  R  S  L  G  R         p.40

          .         .         .  | 03      .         .         .    g.28574
 CGCCGCGCGCCCTTCGCGCTGAGCAGTGACT | CAAATATGCCAGAGGATTATCCTGATCAG    c.180
 R  R  A  P  F  A  L  S  S  D  S |   N  M  P  E  D  Y  P  D  Q      p.60

          .         .         .         .         .         .       g.28634
 TTCGATGATGTCATGGATTTTATTCAAGCCACCATTAAAAGACTGAAAAGGTCACCAGAT       c.240
 F  D  D  V  M  D  F  I  Q  A  T  I  K  R  L  K  R  S  P  D         p.80

          .         .         .         .         .         .       g.28694
 AAACAAATGGCAGTGCTTCCTAGAAGAGAGCGGAATCGGCAGGCTGCAGCTGCCAACCCA       c.300
 K  Q  M  A  V  L  P  R  R  E  R  N  R  Q  A  A  A  A  N  P         p.100

          .         .         .         .         .         .       g.28754
 GAGAATTCCAGAGGAAAAGGTCGGAGAGGCCAGAGGGGCAAAAACCGGGGTTGTGTCTTA       c.360
 E  N  S  R  G  K  G  R  R  G  Q  R  G  K  N  R  G  C  V  L         p.120

          .         .         .         .         .         .       g.28814
 ACTGCAATACATTTAAATGTCACTGACTTGGGTCTGGGCTATGAAACCAAGGAGGAACTG       c.420
 T  A  I  H  L  N  V  T  D  L  G  L  G  Y  E  T  K  E  E  L         p.140

          .         .         .         .         .         .       g.28874
 ATTTTTAGGTACTGCAGCGGCTCTTGCGATGCAGCTGAGACAACGTACGACAAAATATTG       c.480
 I  F  R  Y  C  S  G  S  C  D  A  A  E  T  T  Y  D  K  I  L         p.160

          .         .         .         .         .         .       g.28934
 AAAAACTTATCCAGAAATAGAAGGCTGGTGAGTGACAAAGTAGGGCAGGCATGTTGCAGA       c.540
 K  N  L  S  R  N  R  R  L  V  S  D  K  V  G  Q  A  C  C  R         p.180

          .         .         .         .         .         .       g.28994
 CCCATCGCCTTTGATGATGACCTGTCGTTTTTAGATGATAACCTGGTTTACCATATTCTA       c.600
 P  I  A  F  D  D  D  L  S  F  L  D  D  N  L  V  Y  H  I  L         p.200

          .         .         .                                     g.29030
 AGAAAGCATTCCGCTAAAAGGTGTGGATGTATCTGA                               c.636
 R  K  H  S  A  K  R  C  G  C  I  X                                 p.211

          .         .         .         .         .         .       g.29090
 ctccggctccagagactgctgtgtattgcattcctgctacagtgcaaagaaagggaccaa       c.*60

          .         .         .         .         .         .       g.29150
 ggttcccaggaaatgtttgcccagaatggaagatgaggaccaaggaggcggaggaggagg       c.*120

          .         .         .         .         .         .       g.29210
 aagaagaagaggaggaggaggaggaggaggaggaggaggaggaaggcagccatcatggga       c.*180

          .         .         .         .         .         .       g.29270
 gcctggtagagggagatccagctacagacaactggacaggagagagagaaaacagccctc       c.*240

          .         .         .         .         .         .       g.29330
 tggattctccaggatggcagccgatgtcactagaagctcagggctgatgttcctggttgg       c.*300

          .         .         .         .         .         .       g.29390
 ctattgccaccatttcagctgatacagtccaccatcactgattaccggcgcggttgcggt       c.*360

          .         .         .         .         .         .       g.29450
 ggatgcacttgaaccaaaccagtgtatctcctgtgatttgttttcatgtgtccgaagaca       c.*420

          .         .         .         .         .         .       g.29510
 ccagggaaacagagatcctggtgttgttccttgttattacgttttactgctgaaagtaag       c.*480

          .         .         .         .         .         .       g.29570
 aggtttatttttctgtcactcagtggagacataccctggaaaggagaggggaaaaaaaaa       c.*540

          .         .         .         .         .         .       g.29630
 gcaaagatacaagagataatcacctttgcatttgaaagttgaggcccgaggtttactaca       c.*600

          .         .         .         .         .         .       g.29690
 accagcatttttgccaacggttggtgattgatttccatcacggtgtgtggggtgggaaga       c.*660

          .         .         .         .         .         .       g.29750
 agttggctaggaaccaaaaaggctgtgctcatgattaaacacaaacctgaaggtatttcc       c.*720

          .         .         .         .         .         .       g.29810
 tttatgtccttggaaacaggaaacgagttgtggttttcgccagcattcttgtaggagaga       c.*780

          .         .         .         .         .         .       g.29870
 atcggggaaggccccgaactgcccccgggcagggagagcccctcaggcctgttggtttac       c.*840

          .         .         .         .         .         .       g.29930
 agagagacagatgttacataaccagctccgttgatgcgtggtcaccagtgaccagagaag       c.*900

          .         .         .         .         .         .       g.29990
 ctactcgatgcaatgcatctgtttcagatacagaaatatagagaagatatttattgaaat       c.*960

          .         .         .         .         .         .       g.30050
 ttaagttattgttatttattaccgttcactaatgaatttctcttttttcccttatttatt       c.*1020

          .         .         .         .         .         .       g.30110
 aaagtttcttttcaaaggtgccaaagtatatgtgctcgcaaaatgcaaagaaaggtgaca       c.*1080

          .         .         .         .         .         .       g.30170
 aaaggaaatttgaattgggaacaagggtccatgcttttcaaagtattaaaaagttttttg       c.*1140

          .         .         .         .         .         .       g.30230
 ccaggcaaaaatcacttactttacctttttaagaaaatttgtcattaattttccccagat       c.*1200

          .         .         .         .         .         .       g.30290
 ttcagcatttttcccaatttttatttgtggagcatctcaggcaagccccctttcctggag       c.*1260

          .         .         .         .         .         .       g.30350
 cagcgtgcagagaccactggcacttgactttatttcttccttgctccattgctgaacaga       c.*1320

          .         .         .         .         .         .       g.30410
 aatgtcgtgggctccacttcctgttgtctttaagctcttagtcccctccacgtataccta       c.*1380

          .         .         .         .         .         .       g.30470
 tctgtactatgcataaccatatgtagaaaaggttcagttccttttagtaggtagtcctgg       c.*1440

          .         .         .         .         .         .       g.30530
 atttaatgctgacctaaaagtaatgtcgacaatgctgtcaggtagctgccgttctaccga       c.*1500

          .         .         .         .         .         .       g.30590
 ctccctccatccctgcccacccactgccctcccgagaatatgctggctgcccagtgcagc       c.*1560

          .         .         .         .         .         .       g.30650
 ccgggagacacaggggccttccagaggtagggtctaccaggtcctgtacaacccctgggc       c.*1620

          .         .         .         .         .         .       g.30710
 tgtcaccgggggtcaacagctgctgctcctatatacccaaacacctgacagctccctggg       c.*1680

          .         .         .         .         .         .       g.30770
 gagcagatggctgagaagggtgctgaggaagccatattgggaccagccacagccacacac       c.*1740

          .         .         .         .         .         .       g.30830
 atggagcctcatacttaggagcgtgctgcctttaaatgaaggtggtcggggccagtgcag       c.*1800

          .         .         .         .         .         .       g.30890
 cggctcacacccataatcccaacactttggaaagccaaggtgggaggatctcttgaaccc       c.*1860

          .         .         .         .         .         .       g.30950
 aggagtttgagaccagcttgggcaacatagggagaccctgtctctacagaaactttaaaa       c.*1920

          .         .         .         .         .         .       g.31010
 attaggcaggcatgatggtgcacacctgtggtcccagctactcaagaggctgaaggagga       c.*1980

          .         .         .         .         .         .       g.31070
 tcacttgagtccagaaggtcgaggctgcagtgagctgtgatcatgccactgcactccagc       c.*2040

          .         .         .         .         .         .       g.31130
 ctaagtgacagtgcggtaccctgtctcaaaaaaaaaaaaaaaaaaaaaaagaggttggag       c.*2100

          .         .         .         .         .         .       g.31190
 caggaggaagcataggggcgggaacagccacctcctccatgccctagattgtgaatttat       c.*2160

          .         .         .         .         .         .       g.31250
 cgggcagccaacacatgtatgacacactaggccctgtattacagcttgttacgcatttca       c.*2220

          .         .         .         .         .         .       g.31310
 taaaagggattttcattaaggagataatctattactacctaccttagtggctactagtat       c.*2280

          .         .         .         .         .         .       g.31370
 aaaactatgacagatttagcaattaaatgaaatactggcctccatcaaataatcatagta       c.*2340

          .         .         .         .         .         .       g.31430
 acaagaagcagcagttaccagacatctgatccccttcccccaaaatacccaaattcttca       c.*2400

          .         .         .         .         .         .       g.31490
 tggttctgcccttctctgtcctttctgctccccttgctcgcctgggaaatggaggaaagg       c.*2460

          .         .         .         .         .         .       g.31550
 ccttccctctcacactgtcttgggatcttgctgagaattcagactgctcgaaacagtgac       c.*2520

          .         .         .         .         .         .       g.31610
 aaaccccagccatccagtcattcgtggagcacaatttggatgtggccccaggggcatctg       c.*2580

          .         .         .         .         .         .       g.31670
 tcccattcagagaaccttggcagtgcgatggccactgttcccaggcttcaacctcagtga       c.*2640

          .         .         .         .         .         .       g.31730
 ccccccccaacaactccccatggagagtccctgcccaaaaaagctgtaggatccaagggg       c.*2700

          .         .         .         .         .         .       g.31790
 tgtcaatagctcgttcccggcatcacctacacaccacaagcaggttttaatggaagcaag       c.*2760

          .         .         .         .         .         .       g.31850
 ttgctccaccaaatccacaaaagggtaaagtttgtgatttttctttatcattgcgatcac       c.*2820

          .         .         .         .         .         .       g.31910
 catctgataccgtaaggagtgcacttgtttggaagttctgacttctctgatctgtcttgg       c.*2880

          .         .         .         .         .         .       g.31970
 tcgtttgtgttataaaaccaaagttctctacagactttatttttgtacaatatcattttg       c.*2940

          .         .         .                                     g.32004
 taactttttacaaataaaaactcatttctattgc                                 c.*2974

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Glial cell derived neurotrophic factor protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.