growth factor, augmenter of liver regeneration (GFER) - 270 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5388
gtgcagttccctgcccgatttctcccagccccgcgcagcccctgtccccgcccccgccca  c.258+60

         .         .         .         .         .         .  g.5448
ggtaccccggcagagcttcccagggttgcctgtccctgaaccttgccccccgggtaggcc  c.258+120

         .       g.5463
cggccttacagcctt  c.258+135

--------------------- middle of intron ---------------------
                                  g.5464          .           g.5478
                                  c.259-135  catccgcgcgtgggt  c.259-121

.         .         .         .         .         .           g.5538
tggatcgtctgcaggactttggccggagtccagtgggccaccggctgggccgtacagtgg  c.259-61

.         .         .         .         .         .           g.5598
ggagctttgggcgcctttgttcggagaatgaactcactctcggtcggcctgcttccgcag  c.259-1


Powered by LOVD v.3.0 Build 15
©2004-2016 Leiden University Medical Center