geranylgeranyl diphosphate synthase 1 (GGPS1) - coding DNA reference sequence

(used for variant description)

(last modified October 30, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_001037277.1 in the GGPS1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering GGPS1 transcript NM_001037277.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5024
                                     cgcgcaaatcctcgtccgcgagaa       c.-61

 .         .         .         .       | 02 .         .             g.11827
 ctgcaaggcccgcaatgccctgcgcctgcgtggaccg | attagctttgaagtttaaatcca    c.-1

          .         .         .         .         .         .       g.11887
 ATGGAGAAGACTCAAGAAACAGTCCAAAGAATTCTTCTAGAACCCTATAAATACTTACTT       c.60
 M  E  K  T  Q  E  T  V  Q  R  I  L  L  E  P  Y  K  Y  L  L         p.20

          . | 03       .         .         .         .         .    g.18320
 CAGTTACCAG | GTAAACAAGTGAGAACCAAACTTTCACAGGCATTTAATCATTGGCTGAAA    c.120
 Q  L  P  G |   K  Q  V  R  T  K  L  S  Q  A  F  N  H  W  L  K      p.40

          .         .  | 04      .         .         .         .    g.18612
 GTTCCAGAGGACAAGCTACAG | ATTATTATTGAAGTGACAGAAATGTTGCATAATGCCAGT    c.180
 V  P  E  D  K  L  Q   | I  I  I  E  V  T  E  M  L  H  N  A  S      p.60

          .         .         .         .         .         .       g.18672
 TTACTCATCGATGATATTGAAGACAACTCAAAACTCCGACGTGGCTTTCCAGTGGCCCAC       c.240
 L  L  I  D  D  I  E  D  N  S  K  L  R  R  G  F  P  V  A  H         p.80

          .         .         .         .         .         .       g.18732
 AGCATCTATGGAATCCCATCTGTCATCAATTCTGCCAATTACGTGTATTTCCTTGGCTTG       c.300
 S  I  Y  G  I  P  S  V  I  N  S  A  N  Y  V  Y  F  L  G  L         p.100

          .         .         .         .         .         .       g.18792
 GAGAAAGTCTTAACCCTTGATCACCCAGATGCAGTGAAGCTTTTTACCCGCCAGCTTTTG       c.360
 E  K  V  L  T  L  D  H  P  D  A  V  K  L  F  T  R  Q  L  L         p.120

          .         .         .         .         .         .       g.18852
 GAACTCCATCAGGGACAAGGCCTAGATATTTACTGGAGGGATAATTACACTTGTCCCACT       c.420
 E  L  H  Q  G  Q  G  L  D  I  Y  W  R  D  N  Y  T  C  P  T         p.140

          .         .         .         .         .         .       g.18912
 GAAGAAGAATATAAAGCTATGGTGCTGCAGAAAACAGGTGGACTGTTTGGATTAGCAGTA       c.480
 E  E  E  Y  K  A  M  V  L  Q  K  T  G  G  L  F  G  L  A  V         p.160

          .         .         .         .         .         .       g.18972
 GGTCTCATGCAGTTGTTCTCTGATTACAAAGAAGATTTAAAACCGCTACTTAATACACTT       c.540
 G  L  M  Q  L  F  S  D  Y  K  E  D  L  K  P  L  L  N  T  L         p.180

          .         .         .         .         .         .       g.19032
 GGGCTCTTTTTCCAAATTAGGGATGATTATGCTAATCTACACTCCAAAGAATATAGTGAA       c.600
 G  L  F  F  Q  I  R  D  D  Y  A  N  L  H  S  K  E  Y  S  E         p.200

          .         .         .         .         .         .       g.19092
 AACAAAAGTTTTTGTGAAGATCTGACAGAGGGAAAGTTCTCATTTCCTACTATTCATGCT       c.660
 N  K  S  F  C  E  D  L  T  E  G  K  F  S  F  P  T  I  H  A         p.220

          .         .         .         .         .         .       g.19152
 ATTTGGTCAAGGCCTGAAAGCACCCAGGTGCAGAATATCTTGCGCCAGAGAACAGAAAAC       c.720
 I  W  S  R  P  E  S  T  Q  V  Q  N  I  L  R  Q  R  T  E  N         p.240

          .         .         .         .         .         .       g.19212
 ATAGATATAAAAAAATACTGTGTACATTATCTTGAGGATGTAGGTTCTTTTGAATACACT       c.780
 I  D  I  K  K  Y  C  V  H  Y  L  E  D  V  G  S  F  E  Y  T         p.260

          .         .         .         .         .         .       g.19272
 CGTAATACCCTTAAAGAGCTTGAAGCTAAAGCCTATAAACAGATTGATGCACGTGGTGGG       c.840
 R  N  T  L  K  E  L  E  A  K  A  Y  K  Q  I  D  A  R  G  G         p.280

          .         .         .         .         .         .       g.19332
 AACCCTGAGCTAGTAGCCTTAGTAAAACACTTAAGTAAGATGTTCAAAGAAGAAAATGAA       c.900
 N  P  E  L  V  A  L  V  K  H  L  S  K  M  F  K  E  E  N  E         p.300

                                                                    g.19335
 TAA                                                                c.903
 X                                                                  p.300

          .         .         .         .         .         .       g.19395
 tgttaagccattcttgattggacctcatagcttattttagttaatcttttttttgtcttt       c.*60

          .         .         .         .         .         .       g.19455
 tagccttaccaccttttaaaaaatttgttattctccagaaacagtaaataggtgagtagg       c.*120

          .         .         .         .         .         .       g.19515
 ggtggtgcaagtgaattcgttttcatttagaagcccctctgtacagataatcaaaattca       c.*180

          .         .         .         .         .         .       g.19575
 aagttgaaagaatcaaaagcagccacagttatgtaggtctgatttgaatgtcataattgc       c.*240

          .         .         .         .         .         .       g.19635
 agtgacaggacattgccaccaactctatcctactaccatcaatgttgtgtttattccgtc       c.*300

          .         .         .         .         .         .       g.19695
 aataaaaaagacttgcttccaggaatttttatccatacactttctaactgtactatctgg       c.*360

          .         .         .         .         .         .       g.19755
 gcagttccaagccagtttctattagctagctggaccaaagaccacaaatctctttttttc       c.*420

          .         .         .         .         .         .       g.19815
 ctaaacgctgctgtaaggaatatctcacttttccccccggaaacaccctcactgaagtct       c.*480

          .         .         .         .         .         .       g.19875
 tctatgaaaaggctgataatgggctgggcgcggtggctcacgcctgtaatcccagcactt       c.*540

          .         .         .         .         .         .       g.19935
 tgggaggccgaggcgggcagatcacgaggtcaggagatcgagaccatcctgacacggtga       c.*600

          .         .         .         .         .         .       g.19995
 aaccctgtctctactaaaaatacaaaaaattagctgggcgtggtggtgggcgcctgtagt       c.*660

          .         .         .         .         .         .       g.20055
 cccagctactcgggaggctgaggcaggagaatggtgtgaacccaggaggcggagcttgca       c.*720

          .         .         .         .         .         .       g.20115
 gtgagccgagatagtgcctctgcactccagcctgggtgacagagcgagactccgtctcaa       c.*780

          .         .         .         .         .         .       g.20175
 aaaaaagggctgataatgataaacagtgagcactccggtcctttttcttaggttttcctt       c.*840

          .         .         .         .         .         .       g.20235
 ttttccttcctctccaccccacaagttttgctttttaaccaaggtgtctctgcttgatga       c.*900

          .         .         .         .         .         .       g.20295
 aattcacatgctagtctaaatctttttttctcccttgtaacatttatgtgccccaaactg       c.*960

          .         .         .         .         .         .       g.20355
 gttagtatatgggtacagcattccctttccaattgggaagcggaaaaagagagtatggga       c.*1020

          .         .         .         .         .         .       g.20415
 tattttagaagggagcctttgaaccttattatatttccccatcattgatagtgacaatct       c.*1080

          .         .         .         .         .         .       g.20475
 taaaagggttgttttcttaccttaagtacaaaagcatggaaaaatgcgcttttccttccc       c.*1140

          .         .         .         .         .         .       g.20535
 gcccacatcaccaccccgacttgaagacagtaggtgcttgaatggaaagtgagtaggcat       c.*1200

          .         .         .         .         .         .       g.20595
 ctttaatcgccctgattaaaggaaagtgttagcctgagagggcctgactgaaaagtaacc       c.*1260

          .         .         .         .         .         .       g.20655
 aaaggcttaatatcaaacactaattagctttttagtgccttaaccctgacctggttacca       c.*1320

          .         .         .         .         .         .       g.20715
 gttttctgtagtttctacacccaagccactgaagtcatctgtggcccaagaggtaggaca       c.*1380

          .         .         .         .         .         .       g.20775
 aaaaaaaaaaaaaaaaaagctgatttcaatatttgatttgttgacatcccaaaatgaaag       c.*1440

          .         .         .         .         .         .       g.20835
 ttttatgtttcccttagaaacatgttttgcttggttctatagtatgttacttaggatcta       c.*1500

          .         .         .         .         .         .       g.20895
 tttaccatatatttgtatgagaaatcctcacccaagcattcaacctaaatctttgaaaag       c.*1560

          .         .         .         .         .         .       g.20955
 ttgggtgctgtctttagtaacttttaaaatagtttaaatctcccattttaatagtgataa       c.*1620

          .         .         .         .         .         .       g.21015
 ggaaacctgttaaaatcatggctattgatgttatagtatggaaagttgaactttatgaac       c.*1680

          .         .         .         .         .         .       g.21075
 ccatacttttaaaaagcatttttaaaaatctaacactgactatagaaacaaattaaaatg       c.*1740

          .         .                                               g.21095
 tctacctttaagtataaaaa                                               c.*1760

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Geranylgeranyl diphosphate synthase 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.