GINS complex subunit 3 (Psf3 homolog) (GINS3) - coding DNA reference sequence

(used for variant description)

(last modified June 9, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_001126129.1 in the GINS3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering GINS3 transcript NM_001126129.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5028
                                 agacttgatcgattgcttctgcctgggc       c.-181

 .         .         .         .         .         .                g.5088
 ggtaccgcccgaattgactgctcctgtctgatgcgtccccgggcgcgggaaacgagtttc       c.-121

 .         .         .         .         .         .                g.5148
 aatccactttcctgaccccaaccatcctgcccagtctccgcttccccgtcttgtacaccc       c.-61

 .         .         .         .         .         .                g.5208
 ctaactcctgaggctcctccgaatcacgcgagtggaagcggagaagctcaagtggccgcc       c.-1

          .         .         .         .         .         .       g.5268
 ATGTCAGAGGCTTATTTCCGAGTGGAGTCGGGTGCGCTGGGGCCTGAGGAGAACTTTCTT       c.60
 M  S  E  A  Y  F  R  V  E  S  G  A  L  G  P  E  E  N  F  L         p.20

          .         .         .         .         .         .       g.5328
 TCTTTGGACGACATCCTGATGTCCCACGAGAAGCTGCCGGTGCGCACGGAGACCGCCATG       c.120
 S  L  D  D  I  L  M  S  H  E  K  L  P  V  R  T  E  T  A  M         p.40

          .         .         .         .         .         .       g.5388
 CCTCGCCTTGGCGCTTTCTTCCTGGAGCGGAGCGCAGGCGCCGAGACTGACAACGCGGTC       c.180
 P  R  L  G  A  F  F  L  E  R  S  A  G  A  E  T  D  N  A  V         p.60

        | 02 .         .         .         .         .         .    g.7762
 CCACAG | GGTTTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGTGTGATATGGCTCACTGCA    c.240
 P  Q   | G  F  A  L  L  P  R  L  E  C  S  G  V  I  W  L  T  A      p.80

          .         .         .         .         .         .       g.7822
 GCCTTGACCTCCCAGGCTCCAGAGATCCTCCCACCTCAGCCACCTATGTGGCTGGTATTG       c.300
 A  L  T  S  Q  A  P  E  I  L  P  P  Q  P  P  M  W  L  V  L         p.100

     | 03    .         .         .         .         .         .    g.15761
 CAG | GGTTCCAAGCTTGAACTACCCTTGTGGCTGGCAAAAGGACTTTTTGACAACAAGCGA    c.360
 Q   | G  S  K  L  E  L  P  L  W  L  A  K  G  L  F  D  N  K  R      p.120

          .         .         .         .         .         .       g.15821
 CGGATCCTTTCTGTGGAACTCCCCAAGATCTACCAAGAGGGTTGGAGGACTGTGTTCAGT       c.420
 R  I  L  S  V  E  L  P  K  I  Y  Q  E  G  W  R  T  V  F  S         p.140

          .         .         .         .         .         .       g.15881
 GCAGATCCCAATGTGGTGGACCTCCACAAAATGGGGCCCCATTTCTACGGGTTTGGCTCC       c.480
 A  D  P  N  V  V  D  L  H  K  M  G  P  H  F  Y  G  F  G  S         p.160

          .         .         .         .         .        | 04.    g.17108
 CAGCTCCTGCATTTTGACAGTCCCGAGAATGCAGACATTTCCCAGTCTCTGCTGCAG | ACT    c.540
 Q  L  L  H  F  D  S  P  E  N  A  D  I  S  Q  S  L  L  Q   | T      p.180

          .         .         .         .         .         .       g.17168
 TTTATCGGACGTTTTCGCCGCATCATGGACTCCTCACAGAATGCTTACAACGAAGACACT       c.600
 F  I  G  R  F  R  R  I  M  D  S  S  Q  N  A  Y  N  E  D  T         p.200

          .         .         .         .         .         .       g.17228
 TCAGCCCTGGTAGCCAGGCTAGACGAGATGGAGAGGGGCTTATTTCAAACAGGGCAGAAA       c.660
 S  A  L  V  A  R  L  D  E  M  E  R  G  L  F  Q  T  G  Q  K         p.220

          .         .         .         .         .         .       g.17288
 GGACTGAATGACTTTCAGTGTTGGGAGAAGGGGCAGGCTTCTCAGATCACAGCTTCCAAC       c.720
 G  L  N  D  F  Q  C  W  E  K  G  Q  A  S  Q  I  T  A  S  N         p.240

          .         .         .         .                           g.17336
 CTCGTTCAGAATTACAAGAAGAGAAAATTCACTGATATGGAAGACTGA                   c.768
 L  V  Q  N  Y  K  K  R  K  F  T  D  M  E  D  X                     p.255

          .         .         .         .         .         .       g.17396
 aagccggaagaacacagaatggctcctcacagacgtatccctccgtgtgtccttgatagg       c.*60

          .         .         .         .         .         .       g.17456
 agctggttgaccttgtacagaaccagaatcctgtcccatttcatggcttatttcctgtgg       c.*120

          .         .         .         .         .         .       g.17516
 ccatagagaattatagggaactggacatgctggaggatgtgggtgtccctggctctgtga       c.*180

          .         .         .         .         .         .       g.17576
 gtcttccaggaccgtcccaccctgctgacccacagcccaggccctttaacccaagaaccc       c.*240

          .         .         .         .         .         .       g.17636
 atggccaaggagaaatcaaagtccttcctaaataagaatcactgccatataatatatcac       c.*300

          .         .         .         .         .         .       g.17696
 agtagagttgcaactgagattccttgtgtctgggagtttggacagcttcagatgtacagt       c.*360

          .         .         .         .         .         .       g.17756
 ttcactagccacaaagcacaggtacaaactgggtcatcgcctgttcacaaaatgctctct       c.*420

          .         .         .         .         .         .       g.17816
 tgatcttatttgcctcatcttcctcatggttgtacagaggatagcaccccaccatgccag       c.*480

          .         .         .         .         .         .       g.17876
 cctgacttggagatatctcctgctgcctgcctgcagggagttaccccagtttccaaaaac       c.*540

          .         .         .         .         .         .       g.17936
 agtcgcccagataaaggaggaaaagggaaaggcagacgaatggcatggcttttactaaag       c.*600

          .         .         .         .         .         .       g.17996
 aaaagatgttggcctcatactctatactcagggcttaatgaactggaatctgcataactc       c.*660

          .         .         .         .         .         .       g.18056
 agcagtcaacccagaagggaaatggttaaactgagcttgttattgcctcggagagcctaa       c.*720

          .         .         .         .         .         .       g.18116
 gagcacccgcacacttaattctactccctgtctagaaaagctgtcagggagtcgtttgga       c.*780

          .         .         .         .         .         .       g.18176
 attgcaatgtagttattaagggctgttaaccagcctgcattacatctggaagtcaggact       c.*840

          .         .         .         .         .         .       g.18236
 tgggtgctgactatgaagggccctgttttcaaaatctaacattgcaagtgtaaatgggca       c.*900

          .         .         .         .         .         .       g.18296
 agaagcctccgttgtgctttttttttcctcttcagtaacttttgcaacattattgcatag       c.*960

          .         .         .         .         .         .       g.18356
 aagatccctgaccatttactaggaacctggttaagcaagcactaatctcttttcctggag       c.*1020

          .         .         .         .         .         .       g.18416
 atcaaggatgcaacctcaggttgagaaagaaacagggttccctgggcccattagactgtt       c.*1080

          .         .         .         .         .         .       g.18476
 tgcagggcatcactgcttccccctgacacctcacaactagcaaaaattgtctttgtcttt       c.*1140

          .         .         .         .         .         .       g.18536
 ggaaattatagagggatttgggtatccagattgtgcagatgcaaacttaggctgtcttga       c.*1200

          .         .         .         .         .         .       g.18596
 tgcaaacttagaaccacagaaatgcttttaaaatgcctgttttaagatggaattgttgtt       c.*1260

          .         .         .         .         .         .       g.18656
 tttataatttgattttagtgctaaataaatgattggctttgtacatgaatatgttctgta       c.*1320

          .         .         .         .         .         .       g.18716
 caagtgctctttcactagtactacagataatcaaagctatcagaattgtgtctttgatca       c.*1380

          .         .         .                                     g.18751
 tatttgacggtaatacacaaatccatgttttagca                                c.*1415

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The GINS complex subunit 3 (Psf3 homolog) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.