gap junction protein, beta 1, 32kDa (GJB1) - coding DNA reference sequence

(used for variant description)

(last modified March 18, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_000166.5 in the GJB1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008357.1, covering GJB1 transcript NM_000166.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.13020
                                   atatgactccccagcaccgggcggtg       c.-121

 .         .         .         .         .         .                g.13080
 atgaattgggacgcaggcgcggagcccagggaccactccccctgcacagacatgagacca       c.-61

 .         .         .         .         .    | 02    .             g.13496
 taggggacctgtctgggtggcctcagggataggcgctccccaag | gtgtgaatgaggcagg    c.-1

          .         .         .         .         .         .       g.13556
 ATGAACTGGACAGGTTTGTACACCTTGCTCAGTGGCGTGAACCGGCATTCTACTGCCATT       c.60
 M  N  W  T  G  L  Y  T  L  L  S  G  V  N  R  H  S  T  A  I         p.20

          .         .         .         .         .         .       g.13616
 GGCCGAGTATGGCTCTCGGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCA       c.120
 G  R  V  W  L  S  V  I  F  I  F  R  I  M  V  L  V  V  A  A         p.40

          .         .         .         .         .         .       g.13676
 GAGAGTGTGTGGGGTGATGAGAAATCTTCCTTCATCTGCAACACACTCCAGCCTGGCTGC       c.180
 E  S  V  W  G  D  E  K  S  S  F  I  C  N  T  L  Q  P  G  C         p.60

          .         .         .         .         .         .       g.13736
 AACAGCGTTTGCTATGACCAATTCTTCCCCATCTCCCATGTGCGGCTGTGGTCCCTGCAG       c.240
 N  S  V  C  Y  D  Q  F  F  P  I  S  H  V  R  L  W  S  L  Q         p.80

          .         .         .         .         .         .       g.13796
 CTCATCCTAGTTTCCACCCCAGCTCTCCTCGTGGCCATGCACGTGGCTCACCAGCAACAC       c.300
 L  I  L  V  S  T  P  A  L  L  V  A  M  H  V  A  H  Q  Q  H         p.100

          .         .         .         .         .         .       g.13856
 ATAGAGAAGAAAATGCTACGGCTTGAGGGCCATGGGGACCCCCTACACCTGGAGGAGGTG       c.360
 I  E  K  K  M  L  R  L  E  G  H  G  D  P  L  H  L  E  E  V         p.120

          .         .         .         .         .         .       g.13916
 AAGAGGCACAAGGTCCACATCTCAGGGACACTGTGGTGGACCTATGTCATCAGCGTGGTG       c.420
 K  R  H  K  V  H  I  S  G  T  L  W  W  T  Y  V  I  S  V  V         p.140

          .         .         .         .         .         .       g.13976
 TTCCGGCTGTTGTTTGAGGCCGTCTTCATGTATGTCTTTTATCTGCTCTACCCTGGCTAT       c.480
 F  R  L  L  F  E  A  V  F  M  Y  V  F  Y  L  L  Y  P  G  Y         p.160

          .         .         .         .         .         .       g.14036
 GCCATGGTGCGGCTGGTCAAGTGCGACGTCTACCCCTGCCCCAACACAGTGGACTGCTTC       c.540
 A  M  V  R  L  V  K  C  D  V  Y  P  C  P  N  T  V  D  C  F         p.180

          .         .         .         .         .         .       g.14096
 GTGTCCCGCCCCACCGAGAAAACCGTCTTCACCGTCTTCATGCTAGCTGCCTCTGGCATC       c.600
 V  S  R  P  T  E  K  T  V  F  T  V  F  M  L  A  A  S  G  I         p.200

          .         .         .         .         .         .       g.14156
 TGCATCATCCTCAATGTGGCCGAGGTGGTGTACCTCATCATCCGGGCCTGTGCCCGCCGA       c.660
 C  I  I  L  N  V  A  E  V  V  Y  L  I  I  R  A  C  A  R  R         p.220

          .         .         .         .         .         .       g.14216
 GCCCAGCGCCGCTCCAATCCACCTTCCCGCAAGGGCTCGGGCTTCGGCCACCGCCTCTCA       c.720
 A  Q  R  R  S  N  P  P  S  R  K  G  S  G  F  G  H  R  L  S         p.240

          .         .         .         .         .         .       g.14276
 CCTGAATACAAGCAGAATGAGATCAACAAGCTGCTGAGTGAGCAGGATGGCTCCCTGAAA       c.780
 P  E  Y  K  Q  N  E  I  N  K  L  L  S  E  Q  D  G  S  L  K         p.260

          .         .         .         .         .         .       g.14336
 GACATACTGCGCCGCAGCCCTGGCACCGGGGCTGGGCTGGCTGAAAAGAGCGACCGCTGC       c.840
 D  I  L  R  R  S  P  G  T  G  A  G  L  A  E  K  S  D  R  C         p.280

          .                                                         g.14348
 TCGGCCTGCTGA                                                       c.852
 S  A  C  X                                                         p.283

          .         .         .         .         .         .       g.14408
 tgccacataccaggcaacctcccatcccacccccgaccctgccctgggcgagcccctcct       c.*60

          .         .         .         .         .         .       g.14468
 tctcccctgccggtgcacaggcctctgcctgctggggattactcgatcaaaaccttcctt       c.*120

          .         .         .         .         .         .       g.14528
 ccctggctacttcccttcctcccggggccttccttttgaggagctggaggggtggggagc       c.*180

          .         .         .         .         .         .       g.14588
 tagaggccacctatgccagtgctcaaggttactgggagtgtgggctgcccttgttgcctg       c.*240

          .         .         .         .         .         .       g.14648
 cacccttccctcttccctctccctctctctgggaccactgggtacaagagatgggatgct       c.*300

          .         .         .         .         .         .       g.14708
 ccgacagcgtctccaattatgaaactaatcttaaccctgtgctgtcagataccctgtttc       c.*360

          .         .         .         .         .         .       g.14768
 tggagtcacatcagtgaggagggatgtgggtaagaggagcagagggcaggggtgctgtgg       c.*420

          .         .         .         .         .         .       g.14828
 acatgtgggtggagaagggagggtggccagcactagtaaaggaggaatagtgcttgctgg       c.*480

          .         .         .         .         .         .       g.14888
 ccacaaggaaaaggaggaggtgtctggggtgagggagttagggagagagaagcaggcaga       c.*540

          .         .         .         .         .         .       g.14948
 taagttggagcaggggttggtcaaggccacctctgcctctagtccccaaggcctctctct       c.*600

          .         .         .         .         .                 g.15004
 gcctgaaatgttacacattaaacaggattttacagtaaatgaagaggtggcttgtg           c.*656

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Gap junction protein, beta 1, 32kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.