gap junction protein, beta 2, 26kDa (GJB2) - coding DNA reference sequence

(used for variant description)

(last modified October 31, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_004004.5 in the GJB2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008358.1, covering GJB2 transcript NM_004004.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5035
                          ggggtgcggttaaaaggcgccacggcgggagacag       c.-181

 .         .         .         .         .         .                g.5095
 gtgttgcggccccgcagcgcccgcgcgctcctctccccgactcggagcccctcggcggcg       c.-121

 .         .         .         .         .         .                g.5155
 cccggcccaggacccgcctaggagcgcaggagccccagcgcagagaccccaacgccgaga       c.-61

 .         .         .         .        | 02.         .             g.8394
 cccccgccccggccccgccgcgcttcctcccgacgcag | agcaaaccgcccagagtagaag    c.-1

          .         .         .         .         .         .       g.8454
 ATGGATTGGGGCACGCTGCAGACGATCCTGGGGGGTGTGAACAAACACTCCACCAGCATT       c.60
 M  D  W  G  T  L  Q  T  I  L  G  G  V  N  K  H  S  T  S  I         p.20

          .         .         .         .         .         .       g.8514
 GGAAAGATCTGGCTCACCGTCCTCTTCATTTTTCGCATTATGATCCTCGTTGTGGCTGCA       c.120
 G  K  I  W  L  T  V  L  F  I  F  R  I  M  I  L  V  V  A  A         p.40

          .         .         .         .         .         .       g.8574
 AAGGAGGTGTGGGGAGATGAGCAGGCCGACTTTGTCTGCAACACCCTGCAGCCAGGCTGC       c.180
 K  E  V  W  G  D  E  Q  A  D  F  V  C  N  T  L  Q  P  G  C         p.60

          .         .         .         .         .         .       g.8634
 AAGAACGTGTGCTACGATCACTACTTCCCCATCTCCCACATCCGGCTATGGGCCCTGCAG       c.240
 K  N  V  C  Y  D  H  Y  F  P  I  S  H  I  R  L  W  A  L  Q         p.80

          .         .         .         .         .         .       g.8694
 CTGATCTTCGTGTCCACGCCAGCGCTCCTAGTGGCCATGCACGTGGCCTACCGGAGACAT       c.300
 L  I  F  V  S  T  P  A  L  L  V  A  M  H  V  A  Y  R  R  H         p.100

          .         .         .         .         .         .       g.8754
 GAGAAGAAGAGGAAGTTCATCAAGGGGGAGATAAAGAGTGAATTTAAGGACATCGAGGAG       c.360
 E  K  K  R  K  F  I  K  G  E  I  K  S  E  F  K  D  I  E  E         p.120

          .         .         .         .         .         .       g.8814
 ATCAAAACCCAGAAGGTCCGCATCGAAGGCTCCCTGTGGTGGACCTACACAAGCAGCATC       c.420
 I  K  T  Q  K  V  R  I  E  G  S  L  W  W  T  Y  T  S  S  I         p.140

          .         .         .         .         .         .       g.8874
 TTCTTCCGGGTCATCTTCGAAGCCGCCTTCATGTACGTCTTCTATGTCATGTACGACGGC       c.480
 F  F  R  V  I  F  E  A  A  F  M  Y  V  F  Y  V  M  Y  D  G         p.160

          .         .         .         .         .         .       g.8934
 TTCTCCATGCAGCGGCTGGTGAAGTGCAACGCCTGGCCTTGTCCCAACACTGTGGACTGC       c.540
 F  S  M  Q  R  L  V  K  C  N  A  W  P  C  P  N  T  V  D  C         p.180

          .         .         .         .         .         .       g.8994
 TTTGTGTCCCGGCCCACGGAGAAGACTGTCTTCACAGTGTTCATGATTGCAGTGTCTGGA       c.600
 F  V  S  R  P  T  E  K  T  V  F  T  V  F  M  I  A  V  S  G         p.200

          .         .         .         .         .         .       g.9054
 ATTTGCATCCTGCTGAATGTCACTGAATTGTGTTATTTGCTAATTAGATATTGTTCTGGG       c.660
 I  C  I  L  L  N  V  T  E  L  C  Y  L  L  I  R  Y  C  S  G         p.220

          .         .                                               g.9075
 AAGTCAAAAAAGCCAGTTTAA                                              c.681
 K  S  K  K  P  V  X                                                p.226

          .         .         .         .         .         .       g.9135
 cgcattgcccagttgttagattaagaaatagacagcatgagagggatgaggcaacccgtg       c.*60

          .         .         .         .         .         .       g.9195
 ctcagctgtcaaggctcagtcgctagcatttcccaacacaaagattctgaccttaaatgc       c.*120

          .         .         .         .         .         .       g.9255
 aaccatttgaaacccctgtaggcctcaggtgaaactccagatgccacaatggagctctgc       c.*180

          .         .         .         .         .         .       g.9315
 tcccctaaagcctcaaaacaaaggcctaattctatgcctgtcttaattttctttcactta       c.*240

          .         .         .         .         .         .       g.9375
 agttagttccactgagaccccaggctgttaggggttattggtgtaaggtactttcatatt       c.*300

          .         .         .         .         .         .       g.9435
 ttaaacagaggatatcggcatttgtttctttctctgaggacaagagaaaaaagccaggtt       c.*360

          .         .         .         .         .         .       g.9495
 ccacagaggacacagagaaggtttgggtgtcctcctggggttctttttgccaactttccc       c.*420

          .         .         .         .         .         .       g.9555
 cacgttaaaggtgaacattggttctttcatttgctttggaagttttaatctctaacagtg       c.*480

          .         .         .         .         .         .       g.9615
 gacaaagttaccagtgccttaaactctgttacactttttggaagtgaaaactttgtagta       c.*540

          .         .         .         .         .         .       g.9675
 tgataggttattttgatgtaaagatgttctggataccattatatgttccccctgtttcag       c.*600

          .         .         .         .         .         .       g.9735
 aggctcagattgtaatatgtaaatggtatgtcattcgctactatgatttaatttgaaata       c.*660

          .         .         .         .         .         .       g.9795
 tggtcttttggttatgaatactttgcagcacagctgagaggctgtctgttgtattcattg       c.*720

          .         .         .         .         .         .       g.9855
 tggtcatagcacctaacaacattgtagcctcaatcgagtgagacagactagaagttccta       c.*780

          .         .         .         .         .         .       g.9915
 gtgatggcttatgatagcaaatggcctcatgtcaaatatttagatgtaattttgtgtaag       c.*840

          .         .         .         .         .         .       g.9975
 aaatacagactggatgtaccaccaactactacctgtaatgacaggcctgtccaacacatc       c.*900

          .         .         .         .         .         .       g.10035
 tcccttttccatgactgtggtagccagcatcggaaagaacgctgatttaaagaggtcgct       c.*960

          .         .         .         .         .         .       g.10095
 tgggaattttattgacacagtaccatttaatggggaggacaaaatggggcaggggaggga       c.*1020

          .         .         .         .         .         .       g.10155
 gaagtttctgtcgttaaaaacagatttggaaagactggactctaaagtctgttgattaaa       c.*1080

          .         .         .         .         .         .       g.10215
 gatgagctttgtctacttcaaaagtttgtttgcttaccccttcagcctccaattttttaa       c.*1140

          .         .         .         .         .         .       g.10275
 gtgaaaatatagctaataacatgtgaaaagaatagaagctaaggtttagataaatattga       c.*1200

          .         .         .         .         .         .       g.10335
 gcagatctataggaagattgaacctgaatattgccattatgcttgacatggtttccaaaa       c.*1260

          .         .         .         .         .         .       g.10395
 aatggtactccacatatttcagtgagggtaagtattttcctgttgtcaagaatagcattg       c.*1320

          .         .         .         .         .         .       g.10455
 taaaagcattttgtaataataaagaatagctttaatgatatgcttgtaactaaaataatt       c.*1380

          .         .         .         .         .                 g.10513
 ttgtaatgtatcaaatacatttaaaacattaaaatataatctctataataatttaaaa         c.*1438

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Gap junction protein, beta 2, 26kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.