gap junction protein, beta 3, 31kDa (GJB3) - coding DNA reference sequence

(used for variant description)

(last modified December 2, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_024009.2 in the GJB3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008309.1, covering GJB3 transcript NM_024009.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5015
                                              gaacttctttcctgg       c.-601

 .         .         .         .         .         .                g.5075
 cacaggactcactgtgccccttcccgctgtgggtacaaggtctgccccccaccccagctc       c.-541

 .         .         .         .         .         .                g.5135
 tccaaagcccaccggcctccctggaggccgaggtcgacggcccgtcgcaccgggaggggg       c.-481

 .         .         .         .         .         .                g.5195
 ggctcccaggggtgccccacgcacggtcaaggtcccgcgccaagcggggaccgggctggg       c.-421

 .         .         .         .         .         .                g.5255
 ccggaagcgggcacggtactcgcggcaaactagcgtgggcgagtcctgattgcagtcgga       c.-361

 .         .         .         .         .         .                g.5315
 cctgccgccgcggcacttaacagtttgcagagtgcttcccgcccctgatctcattggagc       c.-301

 .         .         .         .         .         .                g.5375
 cttcggacagcccagcccatggccaccgatgcccccatttcacgcctgaggaagcggagg       c.-241

 .         .         .         .         .         .                g.5435
 ctcagacgggccaccagcccctccggaggctggcccgggagcgcctggcagcgtcgggtc       c.-181

 .         .         .         .         .         .                g.5495
 taggagccggctccctcctgctccctcctccgcgccgcccggggtgtgcccgccgtctgt       c.-121

 .         .         .         .         .         .                g.5555
 gtgcaccactgctgagcccagctccggcgccctcgcctctgctgtgggccccggggacgc       c.-61

 .         .         .         .     | 02   .         .             g.8574
 ggggtcaggccaccgcgttggccaggccgctgcag | gtaggcacggcccccaccaggcgcc    c.-1

          .         .         .         .         .         .       g.8634
 ATGGACTGGAAGACACTCCAGGCCCTACTGAGCGGTGTGAACAAGTACTCCACAGCGTTC       c.60
 M  D  W  K  T  L  Q  A  L  L  S  G  V  N  K  Y  S  T  A  F         p.20

          .         .         .         .         .         .       g.8694
 GGGCGCATCTGGCTGTCCGTGGTGTTCGTCTTCCGGGTGCTGGTATACGTGGTGGCTGCA       c.120
 G  R  I  W  L  S  V  V  F  V  F  R  V  L  V  Y  V  V  A  A         p.40

          .         .         .         .         .         .       g.8754
 GAGCGCGTGTGGGGGGATGAGCAGAAGGACTTTGACTGCAACACCAAGCAGCCCGGCTGC       c.180
 E  R  V  W  G  D  E  Q  K  D  F  D  C  N  T  K  Q  P  G  C         p.60

          .         .         .         .         .         .       g.8814
 ACCAACGTCTGCTACGACAACTACTTCCCCATCTCCAACATCCGCCTCTGGGCCCTGCAG       c.240
 T  N  V  C  Y  D  N  Y  F  P  I  S  N  I  R  L  W  A  L  Q         p.80

          .         .         .         .         .         .       g.8874
 CTCATCTTCGTCACATGCCCCTCGCTGCTGGTCATCCTGCACGTGGCCTACCGTGAGGAG       c.300
 L  I  F  V  T  C  P  S  L  L  V  I  L  H  V  A  Y  R  E  E         p.100

          .         .         .         .         .         .       g.8934
 CGGGAGCGCCGGCACCGCCAGAAACACGGGGACCAGTGCGCCAAGCTGTACGACAACGCA       c.360
 R  E  R  R  H  R  Q  K  H  G  D  Q  C  A  K  L  Y  D  N  A         p.120

          .         .         .         .         .         .       g.8994
 GGCAAGAAGCACGGAGGCCTGTGGTGGACCTACCTGTTCAGCCTCATCTTCAAGCTCATC       c.420
 G  K  K  H  G  G  L  W  W  T  Y  L  F  S  L  I  F  K  L  I         p.140

          .         .         .         .         .         .       g.9054
 ATTGAGTTCCTCTTCCTCTACCTGCTGCACACTCTCTGGCATGGCTTCAATATGCCGCGC       c.480
 I  E  F  L  F  L  Y  L  L  H  T  L  W  H  G  F  N  M  P  R         p.160

          .         .         .         .         .         .       g.9114
 CTGGTGCAGTGTGCCAACGTGGCCCCCTGCCCCAACATCGTGGACTGCTACATTGCCCGA       c.540
 L  V  Q  C  A  N  V  A  P  C  P  N  I  V  D  C  Y  I  A  R         p.180

          .         .         .         .         .         .       g.9174
 CCTACCGAGAAGAAAATCTTCACCTACTTCATGGTGGGCGCCTCCGCCGTCTGCATCGTA       c.600
 P  T  E  K  K  I  F  T  Y  F  M  V  G  A  S  A  V  C  I  V         p.200

          .         .         .         .         .         .       g.9234
 CTCACCATCTGTGAGCTCTGCTACCTCATCTGCCACAGGGTCCTGCGAGGCCTGCACAAG       c.660
 L  T  I  C  E  L  C  Y  L  I  C  H  R  V  L  R  G  L  H  K         p.220

          .         .         .         .         .         .       g.9294
 GACAAGCCTCGAGGGGGTTGCAGCCCCTCGTCCTCCGCCAGCCGAGCTTCCACCTGCCGC       c.720
 D  K  P  R  G  G  C  S  P  S  S  S  A  S  R  A  S  T  C  R         p.240

          .         .         .         .         .         .       g.9354
 TGCCACCACAAGCTGGTGGAGGCTGGGGAGGTGGATCCAGACCCAGGCAATAACAAGCTG       c.780
 C  H  H  K  L  V  E  A  G  E  V  D  P  D  P  G  N  N  K  L         p.260

          .         .         .                                     g.9387
 CAGGCTTCAGCACCCAACCTGACCCCCATCTGA                                  c.813
 Q  A  S  A  P  N  L  T  P  I  X                                    p.270

          .         .         .         .         .         .       g.9447
 ccacagggcaggggtggggcaacatgcgggctgccaatgggacatgcagggcggtgtggc       c.*60

          .         .         .         .         .         .       g.9507
 aggtggagaggtcctacaggggctgagtgaccccactctgagttcactaagttatgcaac       c.*120

          .         .         .         .         .         .       g.9567
 tttcgttttggcagatattttttgacactgggaactgggctgtctagccgggtataggta       c.*180

          .         .         .         .         .         .       g.9627
 acccacaggcccagtgccagccctcaaaggacatagactttgaaacaagcgaattaacta       c.*240

          .         .         .         .         .         .       g.9687
 tctacgctgcctgcaaggggccacttagggcactgctagcagggcttcaaccaggaaggg       c.*300

          .         .         .         .         .         .       g.9747
 atcaacccaggaagggatgatcaggagaggcttccctgaggacataatgtgtaagagagg       c.*360

          .         .         .         .         .         .       g.9807
 tgagaagtgctcccaagcagacacaacagcagcacagaggtctggaggccacacaaaaag       c.*420

          .         .         .         .         .         .       g.9867
 tgatgctcgccctgggctagcctcagcagacctaaggcatctctactccctccagaggag       c.*480

          .         .         .         .         .         .       g.9927
 ccgcccagattcctgcagtggagaggaggtcttccagcagcagcaggtctggagggctga       c.*540

          .         .         .         .         .         .       g.9987
 gaatgaacctgactagaggttctggagatacccagaggtcccccaggtcatcacttggct       c.*600

          .         .         .         .         .         .       g.10047
 cagtggaagccctctttccccaaatcctactccctcagcctcaggcagtggtgctcccat       c.*660

          .         .         .         .         .         .       g.10107
 cttcctccccacaactgtgctcaggctggtgccagcctttcagaccctgctcccagggac       c.*720

          .         .         .         .         .         .       g.10167
 ttgggtggatgcgctgatagaacatcctcaagacagtttccttgaaatcaataaatactg       c.*780

                                                                    g.10176
 tgttttata                                                          c.*789

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Gap junction protein, beta 3, 31kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.