gap junction protein, beta 6, 30kDa (GJB6) - coding DNA reference sequence

(used for variant description)

(last modified January 18, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_006783.4 in the GJB6 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008323.1, covering GJB6 transcript NM_006783.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.6175
                                                cttttccctcaag       c.-541

 .         .         .         .         .         .                g.6235
 tagactttatgccatacagctattttcttgccccagttctagcagaatctaaccagtgtt       c.-481

 .         .         .         .         .         .                g.6295
 ctagaagaaaatgtcctgcccccatgcagtctccttagaattgcagggtgctgctcagaa       c.-421

 .         .         .         .         .         .                g.6355
 ctgctcctgtggagagctttgtctgttgtttggatccagcagcgtctttgggggtgttgc       c.-361

 .         .         .         .         .         .                g.6415
 ttgaagcttgccaaggaggagaggggggttctgaagagagaacaccagggctctagcctg       c.-301

 .         .         .         .         .         .                g.6475
 tcacataactgggggtgtggagagcgcctcattgccactgcagtgactaaagctgggaag       c.-241

 .         .         .         .         .         .     | 02       g.7651
 acgctggtcagttcacctgccccactggttgttttttaaacaaattctgatacag | gcgac    c.-181

 .         .         .         .         .         .                g.7711
 atcctcactgaccgagcaaagattgacattcgtatcatcactgtgcaccattggcttcta       c.-121

 .         .         .         .         .         .                g.7771
 ggcactccagtggggtaggagaaggaggtctgaaaccctcgcagagggatcttgccctca       c.-61

 .         .         .         .         .     | 03   .             g.13915
 ttctttgggtctgaaacactggcagtcgttggaaacaggactcag | ggataaaccagcgca    c.-1

          .         .         .         .         .         .       g.13975
 ATGGATTGGGGGACGCTGCACACTTTCATCGGGGGTGTCAACAAACACTCCACCAGCATC       c.60
 M  D  W  G  T  L  H  T  F  I  G  G  V  N  K  H  S  T  S  I         p.20

          .         .         .         .         .         .       g.14035
 GGGAAGGTGTGGATCACAGTCATCTTTATTTTCCGAGTCATGATCCTCGTGGTGGCTGCC       c.120
 G  K  V  W  I  T  V  I  F  I  F  R  V  M  I  L  V  V  A  A         p.40

          .         .         .         .         .         .       g.14095
 CAGGAAGTGTGGGGTGACGAGCAAGAGGACTTCGTCTGCAACACACTGCAACCGGGATGC       c.180
 Q  E  V  W  G  D  E  Q  E  D  F  V  C  N  T  L  Q  P  G  C         p.60

          .         .         .         .         .         .       g.14155
 AAAAATGTGTGCTATGACCACTTTTTCCCGGTGTCCCACATCCGGCTGTGGGCCCTCCAG       c.240
 K  N  V  C  Y  D  H  F  F  P  V  S  H  I  R  L  W  A  L  Q         p.80

          .         .         .         .         .         .       g.14215
 CTGATCTTCGTCTCCACCCCAGCGCTGCTGGTGGCCATGCATGTGGCCTACTACAGGCAC       c.300
 L  I  F  V  S  T  P  A  L  L  V  A  M  H  V  A  Y  Y  R  H         p.100

          .         .         .         .         .         .       g.14275
 GAAACCACTCGCAAGTTCAGGCGAGGAGAGAAGAGGAATGATTTCAAAGACATAGAGGAC       c.360
 E  T  T  R  K  F  R  R  G  E  K  R  N  D  F  K  D  I  E  D         p.120

          .         .         .         .         .         .       g.14335
 ATTAAAAAGCAGAAGGTTCGGATAGAGGGGTCGCTGTGGTGGACGTACACCAGCAGCATC       c.420
 I  K  K  Q  K  V  R  I  E  G  S  L  W  W  T  Y  T  S  S  I         p.140

          .         .         .         .         .         .       g.14395
 TTTTTCCGAATCATCTTTGAAGCAGCCTTTATGTATGTGTTTTACTTCCTTTACAATGGG       c.480
 F  F  R  I  I  F  E  A  A  F  M  Y  V  F  Y  F  L  Y  N  G         p.160

          .         .         .         .         .         .       g.14455
 TACCACCTGCCCTGGGTGTTGAAATGTGGGATTGACCCCTGCCCCAACCTTGTTGACTGC       c.540
 Y  H  L  P  W  V  L  K  C  G  I  D  P  C  P  N  L  V  D  C         p.180

          .         .         .         .         .         .       g.14515
 TTTATTTCTAGGCCAACAGAGAAGACCGTGTTTACCATTTTTATGATTTCTGCGTCTGTG       c.600
 F  I  S  R  P  T  E  K  T  V  F  T  I  F  M  I  S  A  S  V         p.200

          .         .         .         .         .         .       g.14575
 ATTTGCATGCTGCTTAACGTGGCAGAGTTGTGCTACCTGCTGCTGAAAGTGTGTTTTAGG       c.660
 I  C  M  L  L  N  V  A  E  L  C  Y  L  L  L  K  V  C  F  R         p.220

          .         .         .         .         .         .       g.14635
 AGATCAAAGAGAGCACAGACGCAAAAAAATCACCCCAATCATGCCCTAAAGGAGAGTAAG       c.720
 R  S  K  R  A  Q  T  Q  K  N  H  P  N  H  A  L  K  E  S  K         p.240

          .         .         .         .         .         .       g.14695
 CAGAATGAAATGAATGAGCTGATTTCAGATAGTGGTCAAAATGCAATCACAGGTTTCCCA       c.780
 Q  N  E  M  N  E  L  I  S  D  S  G  Q  N  A  I  T  G  F  P         p.260

                                                                    g.14701
 AGCTAA                                                             c.786
 S  X                                                               p.261

          .         .         .         .         .         .       g.14761
 acatttcaaggtaaaatgtagctgcgtcataaggagacttctgtcttctccagaaggcaa       c.*60

          .         .         .         .         .         .       g.14821
 taccaacctgaaagttccttctgtagcctgaagagtttgtaaatgactttcataataaat       c.*120

          .         .         .         .         .         .       g.14881
 agacacttgagttaactttttgtaggatacttgctccattcatacacaacgtaatcaaat       c.*180

          .         .         .         .         .         .       g.14941
 atgtggtccatctctgaaaacaagagactgcttgacaaaggagcattgcagtcactttga       c.*240

          .         .         .         .         .         .       g.15001
 caggttccttttaagtggactctctgacaaagtgggtactttctgaaaatttatataact       c.*300

          .         .         .         .         .         .       g.15061
 gttgttgataaggaacatttatccaggaattgatacgtttattaggaaaagatattttta       c.*360

          .         .         .         .         .         .       g.15121
 taggcttggatgtttttagttctgactttgaatttatataaagtatttttataatgactg       c.*420

          .         .         .         .         .         .       g.15181
 gtcttccttacctggaaaaacatgcgatgttagttttagaattacaccacaagtatctaa       c.*480

          .         .         .         .         .         .       g.15241
 atttggaacttacaaagggtctatcttgtaaatattgttttgcattgtctgttggcaaat       c.*540

          .         .         .         .         .         .       g.15301
 ttgtgaactgtcatgatacgcttaaggtggaaagtgttcattgcacaatatatttttact       c.*600

          .         .         .         .         .         .       g.15361
 gctttctgaatgtagacggaacagtgtggaagcagaaggcttttttaactcatccgtttg       c.*660

          .         .         .         .         .         .       g.15421
 ccaatcattgcaaacaactgaaatgtggatgtgattgcctcaataaagctcgtccccatt       c.*720

          .                                                         g.15434
 gcttaagccttca                                                      c.*733

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Gap junction protein, beta 6, 30kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center