geminin, DNA replication inhibitor (GMNN) - coding DNA reference sequence

(used for variant description)

(last modified January 6, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_015895.4 in the GMNN gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_030440.1, covering GMNN transcript NM_015895.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5039
                      gtctgcgtcagttggtcacgtggttgttcggagcgggcg       c.-301

 .         .         .         .         .         .                g.5099
 agcggagttagcagggctttactgcagagcgcgccgggcactccagcgaccgtggggatc       c.-241

 .         .         .         .         .         .                g.5159
 agcgtaggtgagctgtggccttttgcgaggtgctgcagccatagctacgtgcgttcgcta       c.-181

 .         .         .         .         .         .                g.5219
 cgaggattgagcgtctccacccagtaagtgggcaagaggcggcaggaagtgggtacgcag       c.-121

 .         .         .         .         .         .                g.5279
 gggcgcaaggcgcacagcctctagacgactcgctttccctccggccaacctctgaagccg       c.-61

 .         .         .         .     | 02   .         .             g.7316
 cgtcctactttgacagctgcagggccgcggcctgg | tcttctgtgcttcaccatctacata    c.-1

          .         .         .         .         .  | 03      .    g.10741
 ATGAATCCCAGTATGAAGCAGAAACAAGAAGAAATCAAAGAGAATATAAAG | AATAGTTCT    c.60
 M  N  P  S  M  K  Q  K  Q  E  E  I  K  E  N  I  K   | N  S  S      p.20

          .         .         .         .         .         .       g.10801
 GTCCCAAGAAGAACTCTGAAGATGATTCAGCCTTCTGCATCTGGATCTCTTGTTGGAAGA       c.120
 V  P  R  R  T  L  K  M  I  Q  P  S  A  S  G  S  L  V  G  R         p.40

           | 04        .         .         .         .         .    g.11597
 GAAAATGAG | CTGTCCGCAGGCTTGTCCAAAAGGAAACATCGGAATGACCACTTAACATCT    c.180
 E  N  E   | L  S  A  G  L  S  K  R  K  H  R  N  D  H  L  T  S      p.60

          .         .         .         .         .         .       g.11657
 ACAACTTCCAGCCCTGGGGTTATTGTCCCAGAATCTAGTGAAAATAAAAATCTTGGAGGA       c.240
 T  T  S  S  P  G  V  I  V  P  E  S  S  E  N  K  N  L  G  G         p.80

          .         .         .     | 05   .         .         .    g.14182
 GTCACCCAGGAGTCATTTGATCTTATGATTAAAG | AAAATCCATCCTCTCAGTATTGGAAG    c.300
 V  T  Q  E  S  F  D  L  M  I  K  E |   N  P  S  S  Q  Y  W  K      p.100

          .         .         .         .         .        | 06.    g.14516
 GAAGTGGCAGAAAAACGGAGAAAGGCGCTGTATGAAGCACTTAAGGAAAATGAGAAA | CTT    c.360
 E  V  A  E  K  R  R  K  A  L  Y  E  A  L  K  E  N  E  K   | L      p.120

          .         .         .         .         .         .       g.14576
 CATAAAGAAATTGAACAAAAGGACAATGAAATTGCCCGCCTGAAAAAGGAGAATAAAGAA       c.420
 H  K  E  I  E  Q  K  D  N  E  I  A  R  L  K  K  E  N  K  E         p.140

          .         .         .         .         | 07         .    g.15719
 CTGGCAGAAGTAGCAGAACATGTACAGTATATGGCAGAGCTAATAGAG | AGACTGAATGGT    c.480
 L  A  E  V  A  E  H  V  Q  Y  M  A  E  L  I  E   | R  L  N  G      p.160

          .         .         .         .         .         .       g.15779
 GAACCTCTGGATAATTTTGAATCACTGGATAATCAGGAATTTGATTCTGAAGAAGAAACT       c.540
 E  P  L  D  N  F  E  S  L  D  N  Q  E  F  D  S  E  E  E  T         p.180

          .         .         .         .         .         .       g.15839
 GTTGAGGATTCTCTAGTGGAAGACTCAGAAATTGGCACGTGTGCTGAAGGAACTGTATCT       c.600
 V  E  D  S  L  V  E  D  S  E  I  G  T  C  A  E  G  T  V  S         p.200

          .         .         .                                     g.15869
 TCCTCTACGGATGCAAAGCCATGTATATGA                                     c.630
 S  S  T  D  A  K  P  C  I  X                                       p.209

          .         .         .         .         .         .       g.15929
 aatgcattaatatttgactgttgagaattttactgccgaagtttacctccactagttctt       c.*60

          .         .         .         .         .         .       g.15989
 tgtagcagagtacataactacataatgccaactctggaatcaaatttccttgtttgaatc       c.*120

          .         .         .         .         .         .       g.16049
 ctgggaccctattgcattaaagtacaaatactatgtatttttaatctatgatggtttatg       c.*180

          .         .         .         .         .         .       g.16109
 tgaataggattttctcagttgtcagccatgacttatgtttattactaaataaacttcaaa       c.*240

          .         .         .         .         .         .       g.16169
 ctcctgttgaacattgtgtataacttagaataatgaaatataaggagtatgtgtagaaaa       c.*300

 

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Geminin, DNA replication inhibitor protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.