golgi SNAP receptor complex member 2 (GOSR2) - coding DNA reference sequence

(used for variant description)

(last modified December 1, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_004287.3 in the GOSR2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_031806.1, covering GOSR2 transcript NM_004287.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5013
                                                aaccggaaggggg       c.-61

 .         .         .         .         .         .                g.5073
 gctgtgaggacgtgttccgaggaagccagagccggagccgtggcctgcggggccggcgac       c.-1

          .         .          | 02        .         .         .    g.11431
 ATGGATCCCCTGTTCCAGCAAACGCACAA | GCAGGTCCACGAGATCCAGTCTTGCATGGGA    c.60
 M  D  P  L  F  Q  Q  T  H  K  |  Q  V  H  E  I  Q  S  C  M  G      p.20

          .         .         .     | 03   .         .         .    g.13005
 CGCCTGGAGACGGCAGACAAGCAGTCTGTGCACA | TAGTAGAAAACGAAATCCAAGCAAGC    c.120
 R  L  E  T  A  D  K  Q  S  V  H  I |   V  E  N  E  I  Q  A  S      p.40

          .         .         .         .         .         .       g.13065
 ATAGACCAGATATTCAGCCGTCTAGAACGTCTGGAGATTTTGTCCAGCAAGGAGCCCCCT       c.180
 I  D  Q  I  F  S  R  L  E  R  L  E  I  L  S  S  K  E  P  P         p.60

          .         .    | 04    .         .         .         .    g.13984
 AACAAAAGGCAAAATGCCAGACT | TCGGGTTGACCAGTTAAAGTATGATGTCCAGCACCTG    c.240
 N  K  R  Q  N  A  R  L  |  R  V  D  Q  L  K  Y  D  V  Q  H  L      p.80

          .         .         .         .         .         .       g.14044
 CAGACTGCGCTCAGAAACTTCCAGCATCGGCGCCATGCAAGGGAGCAGCAGGAGAGACAG       c.300
 Q  T  A  L  R  N  F  Q  H  R  R  H  A  R  E  Q  Q  E  R  Q         p.100

          .         .         .       | 05 .         .         .    g.16933
 CGAGAAGAGCTTCTGTCTCGAACCTTCACCACTAAC | GACTCTGACACCACCATACCAATG    c.360
 R  E  E  L  L  S  R  T  F  T  T  N   | D  S  D  T  T  I  P  M      p.120

          .         .         .         .         .         .       g.16993
 GACGAATCACTGCAGTTTAACTCCTCCCTCCAGAAAGTTCACAACGGCATGGATGACCTC       c.420
 D  E  S  L  Q  F  N  S  S  L  Q  K  V  H  N  G  M  D  D  L         p.140

          .         .         .         .         .        | 06.    g.20482
 ATTTTAGATGGGCACAATATTTTAGATGGACTGAGGACCCAGAGACTGACCTTGAAG | GGG    c.480
 I  L  D  G  H  N  I  L  D  G  L  R  T  Q  R  L  T  L  K   | G      p.160

          .         .         .         .         .         .       g.20542
 ACTCAGAAGAAGATCCTTGACATTGCCAACATGCTGGGCTTGTCCAACACAGTGATGCGG       c.540
 T  Q  K  K  I  L  D  I  A  N  M  L  G  L  S  N  T  V  M  R         p.180

          .         .         .         .         .         .       g.20602
 CTCATCGAGAAGCGGGCTTTCCAGGACAAGTACTTTATGATAGGTGGGATGCTGCTGACC       c.600
 L  I  E  K  R  A  F  Q  D  K  Y  F  M  I  G  G  M  L  L  T         p.200

          .         .         .                                     g.20641
 TGTGTGGTCATGTTCCTCGTGGTGCAGTACCTGACATGA                            c.639
 C  V  V  M  F  L  V  V  Q  Y  L  T  X                              p.212

          .         .         .         .         .         .       g.20701
 gccagccacgctcagtggctgaacagcattcccacagcctgcaagtgtgtgtgtgtgtga       c.*60

          .         .         .         .         .         .       g.20761
 aagagagaggggggcccagaggccgccttttgaaatgtttgcctgtctgaactgtgaaga       c.*120

          .         .         .         .         .         .       g.20821
 cacttgggagtgattgtggtctaatttccaacctgctctgttttctgtgacatcttggag       c.*180

          .         .         .         .         .         .       g.20881
 ggggagctagtgccaccaccatgcgcggtgcttaggaaatgaaagaagtcccgggtctgt       c.*240

          .         .         .         .         .         .       g.20941
 ctctctcactctcgctctcactgggggagggaaagaatggctttggtggctttgttcaca       c.*300

          .         .         .         .         .         .       g.21001
 tagctgatgcgtgccctgggaaggtgtccacagtgagccctgtgtgcaggactgtccaca       c.*360

          .         .         .         .         .         .       g.21061
 cggttcacaccttgtcaccatcaggcctttctggctcctgatagggtggagcaaaagtgg       c.*420

          .         .         .         .         .         .       g.21121
 aaaggaaaggaaagaggccttttctcacagccattatattaaatagtaggtcgattcaca       c.*480

          .         .         .         .         .         .       g.21181
 tcctcgtgctcctggccaccctcccctgtgcctcagtgacatgtagatgactgactgcca       c.*540

          .         .         .         .         .         .       g.21241
 atacttgtcaccattccctggaagcagctacctaggggaaacaagatgtagtgctattgc       c.*600

          .         .         .         .         .         .       g.21301
 cgataacaagtaagattttccacactacagctgggtgtttctcttttctaaagtgaggcc       c.*660

          .         .         .         .         .         .       g.21361
 agtgttatttcccgggagtgttcagtcttgaccctagtcactgattttttctagttgtta       c.*720

          .         .         .         .         .         .       g.21421
 atagagtggttggcttttaaggttcagagactgtggcttggcacctgcgcccaggctttg       c.*780

          .         .         .         .         .         .       g.21481
 tgggcctttgccccttagaaagtagctgtaggcaaagatttgtgattttccaattacagt       c.*840

          .         .         .         .         .         .       g.21541
 ctcagctctagttttagtatctctaattctttggttcccttctcttccctgaaatatatt       c.*900

          .         .         .         .         .         .       g.21601
 agcacctgccagccaggccctcattttgcccagccagtgtgggcagatcccaccgtggag       c.*960

          .         .         .         .         .         .       g.21661
 acatctgtagtgtgtatgtccttgtaacactctgttttcagggactacaacctttttcct       c.*1020

          .         .         .         .         .         .       g.21721
 tctgtgaccagccccggattcaggctgtactaataccaggtatattgtggaatttagtat       c.*1080

          .         .         .         .         .         .       g.21781
 aaaggccaatctgtcctgaagtccatctaatgtggtgaatcactgaaagtctcagaaaga       c.*1140

          .         .         .         .         .         .       g.21841
 cctggttagtgtatgttctcatttaccacaggcctaccagccctgggcacagcagcttca       c.*1200

          .         .         .         .         .         .       g.21901
 tggcaagacataaaatgacactcaaaatccttcagatctggaaaccggctcagtattaac       c.*1260

          .         .         .         .         .         .       g.21961
 cctacctttggttgtcctgccctacctgctctgttagtttcttgttgcttgaactgtctt       c.*1320

          .         .         .         .         .         .       g.22021
 ctgtcttatttcccttcctttctgtgttcctcttcacctctcttgttcccctccccgctg       c.*1380

          .         .         .         .         .         .       g.22081
 ctctgtagtcatgttggtcctttcaggcacctctgtggcatagctcccctttggtaagtt       c.*1440

          .         .         .         .         .         .       g.22141
 ttcttaattgtcatagattaactgagtttcctggatgctaatttcacactttcggttgga       c.*1500

          .         .         .         .         .         .       g.22201
 ggagatctccattgttcctacccctccgggccaaatgggccccaggtttccaaggaagga       c.*1560

          .         .         .         .         .         .       g.22261
 gcaatctgtgactcctaaaatgggttggggccctgccagagttaaagcagtgactggagg       c.*1620

          .         .         .         .         .         .       g.22321
 gtggactggggggttgcagcatctttagacctagatctgtctaactctggggaggcacat       c.*1680

          .         .         .         .         .         .       g.22381
 tgacatttccattacacacagcactgctgcggtgccagggacctagcgcaggacttttgg       c.*1740

          .         .         .         .         .         .       g.22441
 taatccataaaatggattctgagactgcgacggcaaggctgtcctgtcccccaggcaccc       c.*1800

          .         .         .         .         .         .       g.22501
 aaggatcctgccagacagcacactttggaggaaggtctgcagggagcagctgagccattt       c.*1860

          .         .         .         .         .         .       g.22561
 gttcttgaactctgggaggcagaagtccccgcacccatcatgcgtggactgataggacat       c.*1920

          .         .         .         .         .         .       g.22621
 cttttcgtggtgtgcaccagtgctttccacacttgacagtggttggctttgatgaaccct       c.*1980

          .         .         .         .         .         .       g.22681
 catgctgcaccttcagagccagtcctctagtttggaataaaaattgcagaggtggttttt       c.*2040

          .         .         .         .         .         .       g.22741
 gggtctttaccacctgcggctggtggacagcagccagtgtgtctggacacccaggggcat       c.*2100

          .         .         .         .         .         .       g.22801
 tgagactgcatgttgtcacatgaccacttctcttcacacatctgctttcagtgcctggtg       c.*2160

          .         .         .         .         .         .       g.22861
 aaaaatagaccttggcctaacagtgtgactctctccaccgcctcagtgtagggaagggtc       c.*2220

          .         .         .         .         .         .       g.22921
 caggccagggaaggagcaccctctagtggaggcgggggtgaattcttaggtcgagctgat       c.*2280

          .         .         .         .         .         .       g.22981
 gcaagaaactccggtagccagcctctgtgaccttgtacatgagtttggtgtgcctattgt       c.*2340

          .         .         .         .         .         .       g.23041
 gatttaaaacaggtgggttatcaagaggaacttgagatctctttattacatggacattta       c.*2400

          .         .         .         .         .         .       g.23101
 cttcagggggaccactgtaagaaaagccaaactccaagaccaagtaagttagaggagtct       c.*2460

          .         .         .         .         .         .       g.23161
 tgattttttagacttcactgcggagttctgtacaccctttgccctgatgaatttgaatgg       c.*2520

          .         .         .         .         .         .       g.23221
 gtttgatttgcaaatttggatttacacccattgttttggaagcacatcagctgaataaag       c.*2580

          .         .                                               g.23248
 ttgaggtttattttatttagaaaatca                                        c.*2607

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Golgi SNAP receptor complex member 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.