glycoprotein Ib (platelet), beta polypeptide (GP1BB) - coding DNA reference sequence

(used for variant description)

(last modified June 12, 2013)

This file was created to facilitate the description of sequence variants on transcript NM_000407.4 in the GP1BB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007974.1, covering GP1BB transcript NM_000407.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5027
                                  agtaagccgggctgccgtcttctcgcc       c.-1

          . | 02       .         .         .         .         .    g.5361
 ATGGGCTCCG | GGCCGCGCGGGGCGCTGAGCTTACTGCTCCTGCTGCTGGCCCCGCCGAGC    c.60
 M  G  S  G |   P  R  G  A  L  S  L  L  L  L  L  L  A  P  P  S      p.20

          .         .         .         .         .         .       g.5421
 CGCCCGGCCGCAGGTTGCCCGGCGCCCTGTAGCTGCGCGGGGACGCTCGTGGACTGCGGG       c.120
 R  P  A  A  G  C  P  A  P  C  S  C  A  G  T  L  V  D  C  G         p.40

          .         .         .         .         .         .       g.5481
 CGCCGCGGGCTGACTTGGGCCTCGCTGCCGACCGCCTTCCCTGTCGACACAACCGAGCTG       c.180
 R  R  G  L  T  W  A  S  L  P  T  A  F  P  V  D  T  T  E  L         p.60

          .         .         .         .         .         .       g.5541
 GTGCTGACCGGCAACAACCTGACGGCGCTGCCGCCGGGGCTGCTGGACGCGCTGCCCGCG       c.240
 V  L  T  G  N  N  L  T  A  L  P  P  G  L  L  D  A  L  P  A         p.80

          .         .         .         .         .         .       g.5601
 CTGCGCACCGCACACCTGGGCGCCAACCCCTGGCGCTGCGACTGCCGCCTTGTGCCGCTG       c.300
 L  R  T  A  H  L  G  A  N  P  W  R  C  D  C  R  L  V  P  L         p.100

          .         .         .         .         .         .       g.5661
 CGCGCCTGGCTGGCCGGCCGCCCCGAGCGTGCGCCCTACCGCGACCTGCGTTGCGTGGCG       c.360
 R  A  W  L  A  G  R  P  E  R  A  P  Y  R  D  L  R  C  V  A         p.120

          .         .         .         .         .         .       g.5721
 CCCCCAGCGCTGCGCGGCCGCCTGCTGCCCTATCTGGCCGAGGACGAGCTGCGCGCCGCT       c.420
 P  P  A  L  R  G  R  L  L  P  Y  L  A  E  D  E  L  R  A  A         p.140

          .         .         .         .         .         .       g.5781
 TGCGCTCCCGGCCCGCTCTGCTGGGGGGCGCTGGCGGCGCAGCTTGCGCTGCTGGGCCTT       c.480
 C  A  P  G  P  L  C  W  G  A  L  A  A  Q  L  A  L  L  G  L         p.160

          .         .         .         .         .         .       g.5841
 GGGCTGCTGCACGCGTTGCTGCTGGTGCTGCTGCTGTGCCGCCTGCGGAGGCTGCGGGCC       c.540
 G  L  L  H  A  L  L  L  V  L  L  L  C  R  L  R  R  L  R  A         p.180

          .         .         .         .         .         .       g.5901
 CGGGCCCGCGCTCGCGCCGCAGCCCGGCTGTCGCTGACCGACCCGCTGGTGGCCGAGCGA       c.600
 R  A  R  A  R  A  A  A  R  L  S  L  T  D  P  L  V  A  E  R         p.200

          .         .                                               g.5922
 GCCGGAACCGACGAGTCCTGA                                              c.621
 A  G  T  D  E  S  X                                                p.206

          .         .         .         .         .         .       g.5982
 ggagagaaccggtgcgtcctgaggagagaaccggcgctgggcaacacgggcctgcaaact       c.*60

          .         .         .         .         .         .       g.6042
 cgacaggaccctgcccgaggggccctcgcgccaacctggaccggtccccgcctcctccgc       c.*120

          .         .         .         .         .         .       g.6102
 tgcccaatctctcagacccaccccacctgcaggcccagaccacgtgggacagaactcctg       c.*180

          .         .         .         .         .         .       g.6162
 cccaccctaccccgagggaggcgaacccgcacttccaggcttgggaggaccatggggcac       c.*240

          .         .         .         .         .         .       g.6222
 aatgcggtccagaccctgctgcgtctcccttccaaactctggtgctgaataaacccttct       c.*300

          .                                                         g.6232
 gatctggtct                                                         c.*310

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Glycoprotein Ib (platelet), beta polypeptide protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.