glycoprotein IX (platelet) (GP9) - coding DNA reference sequence

(used for variant description)

(last modified June 12, 2013)

This file was created to facilitate the description of sequence variants on transcript NM_000174.3 in the GP9 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008715.1, covering GP9 transcript NM_000174.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5007
                                                      gccagga       c.-181

 .         .         .         .         .  | 02      .             g.5710
 cctttcaggccagacaggagcacctgaccaaaggcttcacag | ccgccctcaccgcccggc    c.-121

 .         .         .         .         .         .                g.5770
 cttctacggtgtccagagacagttagccaggcctgggctgggcacactccaccttcccta       c.-61

 .         .         .         .         .        | 03.             g.5938
 gtcaccagctggtttcccagaggagaaggctgagacccgagaagggag | ccagcctgtccc    c.-1

          .         .         .         .         .         .       g.5998
 ATGCCTGCCTGGGGAGCCCTGTTCCTGCTCTGGGCCACAGCAGAGGCCACCAAGGACTGC       c.60
 M  P  A  W  G  A  L  F  L  L  W  A  T  A  E  A  T  K  D  C         p.20

          .         .         .         .         .         .       g.6058
 CCCAGCCCATGTACCTGCCGCGCCCTGGAAACCATGGGGCTGTGGGTGGACTGCAGGGGC       c.120
 P  S  P  C  T  C  R  A  L  E  T  M  G  L  W  V  D  C  R  G         p.40

          .         .         .         .         .         .       g.6118
 CACGGACTCACGGCCCTGCCTGCCCTGCCGGCCCGCACCCGCCACCTTCTGCTGGCCAAC       c.180
 H  G  L  T  A  L  P  A  L  P  A  R  T  R  H  L  L  L  A  N         p.60

          .         .         .         .         .         .       g.6178
 AACAGCCTTCAGTCCGTGCCCCCGGGAGCCTTTGACCACCTGCCCCAGCTGCAGACCCTC       c.240
 N  S  L  Q  S  V  P  P  G  A  F  D  H  L  P  Q  L  Q  T  L         p.80

          .         .         .         .         .         .       g.6238
 GATGTGACGCAGAACCCCTGGCACTGTGACTGCAGCCTCACCTATCTGCGCCTCTGGCTG       c.300
 D  V  T  Q  N  P  W  H  C  D  C  S  L  T  Y  L  R  L  W  L         p.100

          .         .         .         .         .         .       g.6298
 GAGGACCGCACGCCCGAGGCCCTGCTGCAGGTCCGCTGTGCCAGCCCCAGCCTCGCTGCC       c.360
 E  D  R  T  P  E  A  L  L  Q  V  R  C  A  S  P  S  L  A  A         p.120

          .         .         .         .         .         .       g.6358
 CATGGCCCGCTGGGCCGGCTGACAGGCTACCAGCTGGGCAGCTGTGGCTGGCAGCTGCAG       c.420
 H  G  P  L  G  R  L  T  G  Y  Q  L  G  S  C  G  W  Q  L  Q         p.140

          .         .         .         .         .         .       g.6418
 GCGTCCTGGGTGCGCCCGGGGGTCTTGTGGGACGTGGCGCTGGTCGCCGTGGCCGCGCTG       c.480
 A  S  W  V  R  P  G  V  L  W  D  V  A  L  V  A  V  A  A  L         p.160

          .         .         .         .         .                 g.6472
 GGCCTGGCTCTTCTGGCTGGCCTGCTGTGTGCCACCACAGAGGCCCTGGATTGA             c.534
 G  L  A  L  L  A  G  L  L  C  A  T  T  E  A  L  D  X               p.177

          .         .         .         .         .         .       g.6532
 gccaggcccccagaacccctggctccaggccagggggccagtccctgaggcaggtcccca       c.*60

          .         .         .         .         .         .       g.6592
 gactccaccaagcctggtcagcccaaaccaccagaagcccagaataaactggcagctcag       c.*120

          .                                                         g.6609
 ctgttttatataagctc                                                  c.*137

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Glycoprotein IX (platelet) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.