glutamate receptor, ionotropic, AMPA 2 (GRIA2) - coding DNA reference sequence

(used for variant description)

(last modified April 30, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_000826.3 in the GRIA2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000004.11, covering GRIA2 transcript NM_000826.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5039
                      gagtcgcgcacgcgcgcccgggactgcctgcccctctct       c.-421

 .         .         .         .         .         .                g.5099
 gtgacttgcctgtgtgtgtgcgtgtgtgtatgtgtgtgtgtgtgtgtgtgtgcgcgcgcg       c.-361

 .         .         .         .         .         .                g.5159
 cgtgagtgagagaggagagagggagaagagagcgcgagagagggtgagtgtgtgtgagtg       c.-301

 .         .         .         .         .         .                g.5219
 catgggagggtgctgaatattccgagacactgggaccacagcggcagctccgctgaaaac       c.-241

 .         .         .         .         .         .                g.5279
 tgcattcagccagtcctccggacttctggagcggggacagggcgcagggcatcagcagcc       c.-181

 .         .         .         .         .         .                g.5339
 accagcaggacctgggaaatagggattcttctgcctccacttcaggttttagcagcttgg       c.-121

 .         .         .         .         .         .                g.5399
 tgctaaattgctgtctcaaaatgcagaggatctaatttgcagaggaaaacagccaaagaa       c.-61

 .         .         .         .         .         .                g.5459
 ggaagaggaggaaaaggaaaaaaaaaggggtatattgtggatgctctacttttcttggaa       c.-1

          .         .         .         .         .         .       g.5519
 ATGCAAAAGATTATGCATATTTCTGTCCTCCTTTCTCCTGTTTTATGGGGACTGATTTTT       c.60
 M  Q  K  I  M  H  I  S  V  L  L  S  P  V  L  W  G  L  I  F         p.20

          .         .         | 02         .         .         .    g.6115
 GGTGTCTCTTCTAACAGCATACAGATAG | GGGGGCTATTTCCTAGGGGCGCCGATCAAGAA    c.120
 G  V  S  S  N  S  I  Q  I  G |   G  L  F  P  R  G  A  D  Q  E      p.40

          .         .         .         .         .         .       g.6175
 TACAGTGCATTTCGAGTAGGGATGGTTCAGTTTTCCACTTCGGAGTTCAGACTGACACCC       c.180
 Y  S  A  F  R  V  G  M  V  Q  F  S  T  S  E  F  R  L  T  P         p.60

          .         .         .         .          | 03        .    g.87979
 CACATCGACAATTTGGAGGTGGCAAACAGCTTCGCAGTCACTAATGCTT | TCTGCTCCCAG    c.240
 H  I  D  N  L  E  V  A  N  S  F  A  V  T  N  A  F |   C  S  Q      p.80

          .         .         .         .         .         .       g.88039
 TTTTCGAGAGGAGTCTATGCTATTTTTGGATTTTATGACAAGAAGTCTGTAAATACCATC       c.300
 F  S  R  G  V  Y  A  I  F  G  F  Y  D  K  K  S  V  N  T  I         p.100

          .         .         .         .         .         .       g.88099
 ACATCATTTTGCGGAACACTCCACGTCTCCTTCATCACTCCCAGCTTCCCAACAGATGGC       c.360
 T  S  F  C  G  T  L  H  V  S  F  I  T  P  S  F  P  T  D  G         p.120

          .         .         .         .         .         .       g.88159
 ACACATCCATTTGTCATTCAGATGAGACCCGACCTCAAAGGAGCTCTCCTTAGCTTGATT       c.420
 T  H  P  F  V  I  Q  M  R  P  D  L  K  G  A  L  L  S  L  I         p.140

          .         .         .         .          | 04        .    g.97106
 GAATACTATCAATGGGACAAGTTTGCATACCTCTATGACAGTGACAGAG | GCTTATCAACA    c.480
 E  Y  Y  Q  W  D  K  F  A  Y  L  Y  D  S  D  R  G |   L  S  T      p.160

          .         .         .         .         .         .       g.97166
 CTGCAAGCTGTGCTGGATTCTGCTGCTGAAAAGAAATGGCAAGTGACTGCTATCAATGTG       c.540
 L  Q  A  V  L  D  S  A  A  E  K  K  W  Q  V  T  A  I  N  V         p.180

          .         .         .         .         .         .       g.97226
 GGAAACATTAACAATGACAAGAAAGATGAGATGTACCGATCACTTTTTCAAGATCTGGAG       c.600
 G  N  I  N  N  D  K  K  D  E  M  Y  R  S  L  F  Q  D  L  E         p.200

          .         .         .         .         .         .       g.97286
 TTAAAAAAGGAACGGCGTGTAATTCTGGACTGTGAAAGGGATAAAGTAAACGACATTGTA       c.660
 L  K  K  E  R  R  V  I  L  D  C  E  R  D  K  V  N  D  I  V         p.220

        | 05 .         .         .         .         .         .    g.102128
 GACCAG | GTTATTACCATTGGAAAACATGTTAAAGGGTACCACTACATCATTGCAAATCTG    c.720
 D  Q   | V  I  T  I  G  K  H  V  K  G  Y  H  Y  I  I  A  N  L      p.240

  | 06       .         .         .         .         .         .    g.105914
  | GGATTTACTGATGGAGACCTATTAAAAATCCAGTTTGGAGGTGCAAATGTCTCTGGATTT    c.780
  | G  F  T  D  G  D  L  L  K  I  Q  F  G  G  A  N  V  S  G  F      p.260

          .         .         .         .         .         .       g.105974
 CAGATAGTGGACTATGATGATTCGTTGGTATCTAAATTTATAGAAAGATGGTCAACACTG       c.840
 Q  I  V  D  Y  D  D  S  L  V  S  K  F  I  E  R  W  S  T  L         p.280

          .         .         .         .   | 07     .         .    g.117253
 GAAGAAAAAGAATACCCTGGAGCTCACACAACAACAATTAAG | TATACTTCTGCTCTGACC    c.900
 E  E  K  E  Y  P  G  A  H  T  T  T  I  K   | Y  T  S  A  L  T      p.300

          .         .         .         .         .         .       g.117313
 TATGATGCCGTTCAAGTGATGACTGAAGCCTTCCGCAACCTAAGGAAGCAAAGAATTGAA       c.960
 Y  D  A  V  Q  V  M  T  E  A  F  R  N  L  R  K  Q  R  I  E         p.320

          .         .         .         .         .         .       g.117373
 ATCTCCCGAAGGGGGAATGCAGGAGACTGTCTGGCAAACCCAGCAGTGCCCTGGGGACAA       c.1020
 I  S  R  R  G  N  A  G  D  C  L  A  N  P  A  V  P  W  G  Q         p.340

          .         .         . | 08       .         .         .    g.117695
 GGTGTAGAAATAGAAAGGGCCCTCAAACAG | GTTCAGGTTGAAGGTCTCTCAGGAAATATA    c.1080
 G  V  E  I  E  R  A  L  K  Q   | V  Q  V  E  G  L  S  G  N  I      p.360

          .         .         .         .         .         .       g.117755
 AAGTTTGACCAGAATGGAAAAAGAATAAACTATACAATTAACATCATGGAGCTCAAAACT       c.1140
 K  F  D  Q  N  G  K  R  I  N  Y  T  I  N  I  M  E  L  K  T         p.380

          .      | 09  .         .         .         .         .    g.118471
 AATGGGCCCCGGAAG | ATTGGCTACTGGAGTGAAGTGGACAAAATGGTTGTTACCCTTACT    c.1200
 N  G  P  R  K   | I  G  Y  W  S  E  V  D  K  M  V  V  T  L  T      p.400

          .         .         .         .         .         .       g.118531
 GAGCTCCCTTCTGGAAATGACACCTCTGGGCTTGAGAATAAGACTGTTGTTGTCACCACA       c.1260
 E  L  P  S  G  N  D  T  S  G  L  E  N  K  T  V  V  V  T  T         p.420

        | 10 .         .         .         .         .         .    g.120141
 ATTTTG | GAATCTCCGTATGTTATGATGAAGAAAAATCATGAAATGCTTGAAGGCAATGAG    c.1320
 I  L   | E  S  P  Y  V  M  M  K  K  N  H  E  M  L  E  G  N  E      p.440

          .         .         .         .         .         .       g.120201
 CGCTATGAGGGCTACTGTGTTGACCTGGCTGCAGAAATCGCCAAACATTGTGGGTTCAAG       c.1380
 R  Y  E  G  Y  C  V  D  L  A  A  E  I  A  K  H  C  G  F  K         p.460

          .         .         .         .         .         .       g.120261
 TACAAGTTGACAATTGTTGGTGATGGCAAGTATGGGGCCAGGGATGCAGACACGAAAATT       c.1440
 Y  K  L  T  I  V  G  D  G  K  Y  G  A  R  D  A  D  T  K  I         p.480

          .         .         .    | 11    .         .         .    g.120820
 TGGAATGGGATGGTTGGAGAACTTGTATATGGG | AAAGCTGATATTGCAATTGCTCCATTA    c.1500
 W  N  G  M  V  G  E  L  V  Y  G   | K  A  D  I  A  I  A  P  L      p.500

          .         .         .         .         .         .       g.120880
 ACTATTACCCTTGTGAGAGAAGAGGTGATTGACTTCTCAAAGCCCTTCATGAGCCTCGGG       c.1560
 T  I  T  L  V  R  E  E  V  I  D  F  S  K  P  F  M  S  L  G         p.520

          .         .         .         .         .         .       g.120940
 ATATCTATCATGATCAAGAAGCCTCAGAAGTCCAAACCAGGAGTGTTTTCCTTTCTTGAT       c.1620
 I  S  I  M  I  K  K  P  Q  K  S  K  P  G  V  F  S  F  L  D         p.540

          .         .         .         .         .         .       g.121000
 CCTTTAGCCTATGAGATCTGGATGTGCATTGTTTTTGCCTACATTGGGGTCAGTGTAGTT       c.1680
 P  L  A  Y  E  I  W  M  C  I  V  F  A  Y  I  G  V  S  V  V         p.560

          .         .         .         .         .         .       g.121060
 TTATTCCTGGTCAGCAGATTTAGCCCCTACGAGTGGCACACTGAGGAGTTTGAAGATGGA       c.1740
 L  F  L  V  S  R  F  S  P  Y  E  W  H  T  E  E  F  E  D  G         p.580

          .         .         .         .         .         .       g.121120
 AGAGAAACACAAAGTAGTGAATCAACTAATGAATTTGGGATTTTTAATAGTCTCTGGTTT       c.1800
 R  E  T  Q  S  S  E  S  T  N  E  F  G  I  F  N  S  L  W  F         p.600

          .         .         .         .     | 12   .         .    g.125696
 TCCTTGGGTGCCTTTATGCAGCAAGGATGCGATATTTCGCCAAG | ATCCCTCTCTGGGCGC    c.1860
 S  L  G  A  F  M  Q  Q  G  C  D  I  S  P  R  |  S  L  S  G  R      p.620

          .         .         .         .         .         .       g.125756
 ATTGTTGGAGGTGTGTGGTGGTTCTTTACCCTGATCATAATCTCCTCCTACACGGCTAAC       c.1920
 I  V  G  G  V  W  W  F  F  T  L  I  I  I  S  S  Y  T  A  N         p.640

          .         .         .         .         .         .       g.125816
 TTAGCTGCCTTCCTGACTGTAGAGAGGATGGTGTCTCCCATCGAAAGTGCTGAGGATCTT       c.1980
 L  A  A  F  L  T  V  E  R  M  V  S  P  I  E  S  A  E  D  L         p.660

          .         .         .         .         .         .       g.125876
 TCTAAGCAAACAGAAATTGCTTATGGAACATTAGACTCTGGCTCCACTAAAGAGTTTTTC       c.2040
 S  K  Q  T  E  I  A  Y  G  T  L  D  S  G  S  T  K  E  F  F         p.680

     | 13    .         .         .         .         .         .    g.144369
 AGG | AGATCTAAAATTGCAGTGTTTGATAAAATGTGGACCTACATGCGGAGTGCGGAGCCC    c.2100
 R   | R  S  K  I  A  V  F  D  K  M  W  T  Y  M  R  S  A  E  P      p.700

          .         .         .         .         .         .       g.144429
 TCTGTGTTTGTGAGGACTACGGCCGAAGGGGTGGCTAGAGTGCGGAAGTCCAAAGGGAAA       c.2160
 S  V  F  V  R  T  T  A  E  G  V  A  R  V  R  K  S  K  G  K         p.720

          .         .         .         .         .         .       g.144489
 TATGCCTACTTGTTGGAGTCCACGATGAACGAGTACATTGAGCAAAGGAAGCCTTGCGAC       c.2220
 Y  A  Y  L  L  E  S  T  M  N  E  Y  I  E  Q  R  K  P  C  D         p.740

          .         .         .         .         .         .       g.144549
 ACCATGAAAGTTGGTGGAAACCTGGATTCCAAAGGCTATGGCATCGCAACACCTAAAGGA       c.2280
 T  M  K  V  G  G  N  L  D  S  K  G  Y  G  I  A  T  P  K  G         p.760

          .  | 14      .         .         .         .         .    g.146003
 TCCTCATTAAG | AACCCCAGTAAATCTTGCAGTATTGAAACTCAGTGAGCAAGGCGTCTTA    c.2340
 S  S  L  R  |  T  P  V  N  L  A  V  L  K  L  S  E  Q  G  V  L      p.780

          .         .         .         .         .         .       g.146063
 GACAAGCTGAAAAACAAATGGTGGTACGATAAAGGTGAATGTGGAGCCAAGGACTCTGGA       c.2400
 D  K  L  K  N  K  W  W  Y  D  K  G  E  C  G  A  K  D  S  G         p.800

        | 15 .         .         .         .         .         .    g.147269
 AGTAAG | GAAAAGACCAGTGCCCTCAGTCTGAGCAACGTTGCTGGAGTATTCTACATCCTT    c.2460
 S  K   | E  K  T  S  A  L  S  L  S  N  V  A  G  V  F  Y  I  L      p.820

          .         .         .         .         .         .       g.147329
 GTCGGGGGCCTTGGTTTGGCAATGCTGGTGGCTTTGATTGAGTTCTGTTACAAGTCAAGG       c.2520
 V  G  G  L  G  L  A  M  L  V  A  L  I  E  F  C  Y  K  S  R         p.840

          .         .         .         .         .         .       g.147389
 GCCGAGGCGAAACGAATGAAGGTGGCAAAGAATGCACAGAATATTAACCCATCTTCCTCG       c.2580
 A  E  A  K  R  M  K  V  A  K  N  A  Q  N  I  N  P  S  S  S         p.860

          .         .         .         .         .         .       g.147449
 CAGAATTCACAGAATTTTGCAACTTATAAGGAAGGTTACAACGTATATGGCATCGAAAGT       c.2640
 Q  N  S  Q  N  F  A  T  Y  K  E  G  Y  N  V  Y  G  I  E  S         p.880

          .                                                     g.147461
 GTTAAAATTTAG |                                                    c.2653
 V  K  I  X                                                      p.883

     | 16    .         .         .         .         .         .    g.147908
 ggg | atgaccttgaatgatgccatgaggaacaaggcaaggctgtcaattacaggaagtact    c.*60

          .         .         .         .         .         .       g.147968
 ggagaaaatggacgtgttatgactccagaatttcccaaagcagtgcatgctgtcccttac       c.*120

          .         .         .         .         .         .       g.148028
 gtgagtcctggcatgggaatgaatgtcagtgtgactgatctctcgtgattgataagaacc       c.*180

          .         .         .         .         .         .       g.148088
 ttttgagtgccttacacaatggttttcttgtgtgtttattgtcaaagtggtgagaggcat       c.*240

          .         .         .         .         .         .       g.148148
 ccagtatcttgaagacttttctttcagccaagaattcttaaatatgtggagttcatcttg       c.*300

          .         .         .         .         .         .       g.148208
 aattgtaaggaatgattaattaaaacacaacatctttttctactcgagttacagacaaag       c.*360

          .         .         .         .         .         .       g.148268
 cgtggtggacatgcacagctaacatggaagtactataatttacctgaagtctttgtacag       c.*420

          .         .         .         .         .         .       g.148328
 acaacaaacctgtttctgcagccactattgttagtctcttgattcataatgacttaagca       c.*480

          .         .         .         .         .         .       g.148388
 cacttgacatcaactgcatcaagatgtgacatgttttataaaaaaaggaaaaaaaacatt       c.*540

          .         .         .         .         .         .       g.148448
 taaaactaaaaaatatttttaggtattttcacaaacaaactggcttttaaataaatttgc       c.*600

          .         .         .         .         .         .       g.148508
 ttccatattggttgaataagacaaaaacaattaaactgagtgggaagtgaataaaaaaag       c.*660

          .         .         .         .         .         .       g.148568
 gctttaggtatcgattccatatttttcaaagccaaatatgtaaatgctaaggaaagtaaa       c.*720

          .         .         .         .         .         .       g.148628
 caaagaggagattccaatcttgtaatttaatattgttattaaaactttaatgtatcctat       c.*780

          .         .         .         .         .         .       g.148688
 tctttaacatttggtgttaatataaaattacttggcaatgcttgacatttgaaataaaca       c.*840

          .         .         .         .         .         .       g.148748
 tttttctattgttttattgcaagtggtccaattaattttgcttagctacagtttggtcat       c.*900

          .         .         .         .         .         .       g.148808
 aaatcaagtgagtttaaagacactaccaagttgttaggtgcccagagaaaatttctccct       c.*960

          .         .         .         .         .         .       g.148868
 tttaaaaaggccaggtgatttttcaaatgtaatcttgcccccaaagtaatatctgaatat       c.*1020

          .         .         .         .         .         .       g.148928
 ctttttgacatgtctaaatatatatatatataaagaaatatttgttaacacaaaagcatt       c.*1080

          .         .         .         .         .         .       g.148988
 tgatctatgtagataaatgctaatagatttaaaaagctaatattaacaaataccagaata       c.*1140

          .         .         .         .         .         .       g.149048
 cgtgaagttccatttttaaagtgtttgagcttacagaagagaaacattcattttaaatga       c.*1200

          .         .         .         .         .         .       g.149108
 agtaaaaaatgccttgaaagtaattctttagatagttgcccattgattaaattccaaaaa       c.*1260

          .         .         .         .         .         .       g.149168
 ctaaatatgtttttagctttaaaattataaaagctgtcataaactttatatattatgaat       c.*1320

          .         .         .         .         .         .       g.149228
 tttaaaatatgtttgagtctcctgcaatatagtttcatcccattgacatcaattaaaaat       c.*1380

          .         .         .         .         .         .       g.149288
 aaccctaatatattatttttatatttattcctcaggtggaatggctattttaatatgccc       c.*1440

          .         .         .         .         .         .       g.149348
 agtgtggataaaatgtcacatttctgtaacttttgactaaagagcctatatttatctagt       c.*1500

          .         .         .         .         .         .       g.149408
 taatgaatttaaaggatctatctttcccttcataaaatacctcttatttccattaaagcc       c.*1560

          .         .         .         .         .         .       g.149468
 ccccaagtttaattaatttaggattttgaatgattattgacatccaatagttatttttaa       c.*1620

          .         .         .         .         .         .       g.149528
 tatttgtattcttgttatttctggaagaaagcctttgtgtagcacttggtattttgcaaa       c.*1680

          .         .         .         .         .         .       g.149588
 gtgcttttaaaacattcttacttaccgtatttcatagaagggaaggaaaaatgtaaggtt       c.*1740

          .         .         .         .         .         .       g.149648
 taacagtaagcacttgcattgaacatggaggcatgtggtatcatgatattcttcactaaa       c.*1800

          .         .         .         .         .         .       g.149708
 tttagctgtccctaatcacagatcctaaggtaatataatataattttagtgcatttctcc       c.*1860

          .         .         .         .         .         .       g.149768
 tcatcaggaatgctggaggtgcattttaagttttaataataagtgctagaatgaccaaat       c.*1920

          .         .         .         .         .         .       g.149828
 tgcagactaattgtttccatattgtacttaaaatgagtttttaaaagtgaaaaagaaatg       c.*1980

          .         .         .         .         .         .       g.149888
 actatatacaatcaatgctatttattgtacctctgggcctactcttctaaaaattgtagc       c.*2040

          .         .         .         .         .         .       g.149948
 ttatcgatttttctctgtcaagcttgaactaatgtaaataattgaaataatgtaaagtta       c.*2100

          .         .         .         .         .         .       g.150008
 tattttcatgtttttatagatacaacatgacaagaatacataatgtaagagtatttcaac       c.*2160

          .         .         .         .         .         .       g.150068
 tatggataatgttgattggataatgcacatctcagttacaagcagtactcatagtttaat       c.*2220

          .         .         .         .         .         .       g.150128
 atccatgtaacggtgcatcaatatattgctatataaatatgtctgtgtgcatataagtga       c.*2280

          .         .         .         .         .         .       g.150188
 aaagtggtcaaacaagagtgatgacagctgtctaaaggtttttttattcattttatataa       c.*2340

          .         .         .         .         .         .       g.150248
 aaactgttatggaaagaccaaaatgtttatgaactattcttatgtaaatttacaattgtc       c.*2400

          .         .         .         .         .         .       g.150308
 ctttactgtacttttttgtttacagtatagtaccttattttctgctgtgttaagtgggtg       c.*2460

          .         .         .         .         .         .       g.150368
 tcaaactccaagaagacatacactttctataacttctattgaagatattggaatttccaa       c.*2520

          .         .         .         .         .         .       g.150428
 tttttcatgtgtactatgtcagaaaatgctttcgattttatttttaaatctaacatcgga       c.*2580

          .         .         .         .         .         .       g.150488
 tggcttttccggagtgttgtaaaaacttcaatcatacataaaacatgttcttacaaaagg       c.*2640

                                                                    g.150492
 caaa                                                               c.*2644

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Glutamate receptor, ionotropic, AMPA 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center