GRIP1 associated protein 1 (GRIPAP1) - coding DNA reference sequence

(used for variant description)

(last modified August 17, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_020137.3 in the GRIPAP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_016263.1, covering GRIPAP1 transcript NM_020137.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5035
                          gcgcagaaagctggcgggggggtggggggaggaac       c.-1

          .         .         .         .   | 02     .         .    g.7777
 ATGGCGCAAGCTCTGTCTGAGGAGGAGTTTCAGCGGATGCAG | GCTCAGCTCCTGGAACTC    c.60
 M  A  Q  A  L  S  E  E  E  F  Q  R  M  Q   | A  Q  L  L  E  L      p.20

          .         .         .         .          | 03        .    g.7975
 CGGACAAACAACTACCAGCTTTCAGATGAACTACGCAAGAATGGTGTTG | AACTCACCAGT    c.120
 R  T  N  N  Y  Q  L  S  D  E  L  R  K  N  G  V  E |   L  T  S      p.40

          .         .         .         .         .  | 04      .    g.9092
 CTTCGACAGAAGGTCGCCTACTTGGATAAGGAGTTCAGCAAAGCTCAGAAG | GCACTGAGC    c.180
 L  R  Q  K  V  A  Y  L  D  K  E  F  S  K  A  Q  K   | A  L  S      p.60

          .         | 05         .         .         .         .    g.9948
 AAGAGCAAGAAAGCTCAG | GAAGTCGAGGTATTGCTGAGTGAAAATGAGATGCTGCAGGCA    c.240
 K  S  K  K  A  Q   | E  V  E  V  L  L  S  E  N  E  M  L  Q  A      p.80

          .         .         .         .         .         .       g.10008
 AAGCTGCACAGCCAGGAGGAGGACTTCCGTTTGCAGAACAGCACACTAATGGCCGAGTTC       c.300
 K  L  H  S  Q  E  E  D  F  R  L  Q  N  S  T  L  M  A  E  F         p.100

        | 06 .         .         .         .         .         .    g.13739
 AGCAAG | CTCTGCAGCCAGATGGAACAGCTGGAGCAAGAGAACCAGCAACTGAAGGAGGGG    c.360
 S  K   | L  C  S  Q  M  E  Q  L  E  Q  E  N  Q  Q  L  K  E  G      p.120

          .         .         .         .         .         .       g.13799
 GCTGCAGGAGCAGGGGTTGCCCAAGCTGGGCCCCTCGTGGATGGGGAGCTGCTGAGGCTA       c.420
 A  A  G  A  G  V  A  Q  A  G  P  L  V  D  G  E  L  L  R  L         p.140

          .         .         .        | 07.         .         .    g.16176
 CAGGCTGAAAACACAGCCTTGCAGAAGAACGTGGCAG | CCCTGCAGGAACGCTATGGGAAA    c.480
 Q  A  E  N  T  A  L  Q  K  N  V  A  A |   L  Q  E  R  Y  G  K      p.160

          .         .         .         .         .         .       g.16236
 GAAGCCGGGAAGTTCTCAGCTGTCAGTGAGGGCCAGGGGGATCCCCCAGGGGGCCCGGCC       c.540
 E  A  G  K  F  S  A  V  S  E  G  Q  G  D  P  P  G  G  P  A         p.180

          .         .         .         .         .         .       g.16296
 CCCACCGTCCTGGCCCCCATGCCGTTGGCAGAGGTGGAGCTGAAATGGGAAATGGAGAAA       c.600
 P  T  V  L  A  P  M  P  L  A  E  V  E  L  K  W  E  M  E  K         p.200

          .         .         .         .   | 08     .         .    g.16549
 GAGGAGAAGAGATTGCTCTGGGAACAGCTGCAAGGCTTAGAG | AGCTCAAAGCAGGCCGAA    c.660
 E  E  K  R  L  L  W  E  Q  L  Q  G  L  E   | S  S  K  Q  A  E      p.220

          .         .         . | 09       .         .         .    g.17290
 ACATCCAGGCTGCAGGAGGAACTTGCTAAG | CTCTCCGAGAAACTGAAAAAGAAACAAGAA    c.720
 T  S  R  L  Q  E  E  L  A  K   | L  S  E  K  L  K  K  K  Q  E      p.240

    | 10     .         .         .         .         . | 11       . g.17563
 AG | TTTTTGCCGTCTGCAGACAGAAAAGGAGACTCTGTTTAATGACAGCAG | GAACAAGATT c.780
 S  |  F  C  R  L  Q  T  E  K  E  T  L  F  N  D  S  R  |  N  K  I   p.260

          .         .         .         .         .         .       g.17623
 GAGGAATTACAACAACGGAAGGAAGCTGATCACAAAGCCCAGTTGGCTCGAACCCAGAAG       c.840
 E  E  L  Q  Q  R  K  E  A  D  H  K  A  Q  L  A  R  T  Q  K         p.280

          .         .         . | 12       .         .         .    g.19095
 CTGCAGCAGGAACTTGAGGCTGCCAATCAG | AGCTTGGCAGAGCTGAGAGATCAGCGGCAG    c.900
 L  Q  Q  E  L  E  A  A  N  Q   | S  L  A  E  L  R  D  Q  R  Q      p.300

          .         .         .         .         | 13         .    g.19396
 GGGGAGCGCCTGGAACATGCAGCAGCTTTGCGGGCCCTACAAGATCAG | GTATCCATCCAG    c.960
 G  E  R  L  E  H  A  A  A  L  R  A  L  Q  D  Q   | V  S  I  Q      p.320

          .         .         .         .         .         .       g.19456
 AGTGCAGATGCACAGGAACAAGTGGAAGGGCTTTTGGCTGAGAACAATGCCTTGAGGACT       c.1020
 S  A  D  A  Q  E  Q  V  E  G  L  L  A  E  N  N  A  L  R  T         p.340

          .         .  | 14      .         .         .         .    g.21899
 AGCCTGGCTGCCCTGGAGCAG | ATCCAAACAGCAAAGACCCAAGAACTGAATATGCTCCGG    c.1080
 S  L  A  A  L  E  Q   | I  Q  T  A  K  T  Q  E  L  N  M  L  R      p.360

          .         .         .         .         .         .       g.21959
 GAACAGACCACTGGGCTGGCAGCTGAGTTGCAGCAGCAGCAGGCTGAGTACGAGGACCTT       c.1140
 E  Q  T  T  G  L  A  A  E  L  Q  Q  Q  Q  A  E  Y  E  D  L         p.380

          .         .         .       | 15 .         .         .    g.23417
 ATGGGACAGAAAGATGACCTCAACTCCCAGCTCCAG | GAGTCATTACGGGCCAATAGTCGA    c.1200
 M  G  Q  K  D  D  L  N  S  Q  L  Q   | E  S  L  R  A  N  S  R      p.400

          .         .         .         .         .         .       g.23477
 CTGCTGGAACAACTTCAAGAAATAGGGCAGGAGAAGGAGCAGTTGACCCAGGAATTACAG       c.1260
 L  L  E  Q  L  Q  E  I  G  Q  E  K  E  Q  L  T  Q  E  L  Q         p.420

          .   | 16     .         .         .         .         .    g.23871
 GAGGCTCGGAAG | AGTGCGGAGAAGCGGAAGGCCATGCTGGATGAGCTAGCAATGGAAACG    c.1320
 E  A  R  K   | S  A  E  K  R  K  A  M  L  D  E  L  A  M  E  T      p.440

          .         .         .         .         .         .       g.23931
 CTGCAAGAGAAGTCCCAGCACAAGGAAGAGCTGGGAGCAGTTCGTCTACGGCATGAGAAG       c.1380
 L  Q  E  K  S  Q  H  K  E  E  L  G  A  V  R  L  R  H  E  K         p.460

          .         .         .         .         .         .       g.23991
 GAGGTGCTGGGGGTGCGTGCCCGCTATGAGCGTGAGCTCCGAGAGCTGCATGAAGACAAG       c.1440
 E  V  L  G  V  R  A  R  Y  E  R  E  L  R  E  L  H  E  D  K         p.480

          .         .         .         .      | 17  .         .    g.24186
 AAGCGTCAGGAGGAGGAGCTCCGTGGGCAGATCCGGGAGGAGAAG | GCCCGGACACGGGAG    c.1500
 K  R  Q  E  E  E  L  R  G  Q  I  R  E  E  K   | A  R  T  R  E      p.500

          .         .         .         .         .         .       g.24246
 CTGGAGACTCTCCAGCAGACAGTGGAAGAACTTCAAGCTCAGGTACATTCCATGGATGGA       c.1560
 L  E  T  L  Q  Q  T  V  E  E  L  Q  A  Q  V  H  S  M  D  G         p.520

          .         .         .          | 18        .         .    g.25412
 GCCAAGGGCTGGTTTGAACGGCGCTTGAAGGAAGCCGAG | GAATCCCTGCAGCAGCAGCAG    c.1620
 A  K  G  W  F  E  R  R  L  K  E  A  E   | E  S  L  Q  Q  Q  Q      p.540

          .         .         .         .         .        | 19.    g.25575
 CAGGAACAAGAGGAAGCCCTCAAGCAGTGTCGGGAGCAGCACGCTGCCGAGCTGAAG | GGC    c.1680
 Q  E  Q  E  E  A  L  K  Q  C  R  E  Q  H  A  A  E  L  K   | G      p.560

          .         .         .         .         .         .       g.25635
 AAGGAGGAGGAGCTACAGGATGTACGGGATCAGCTCGAGCAGGCCCAGGAGGAGCGGGAC       c.1740
 K  E  E  E  L  Q  D  V  R  D  Q  L  E  Q  A  Q  E  E  R  D         p.580

          .         .         .    | 20    .         .         .    g.25818
 TGCCACCTGAAGACCATTAGCAGCCTGAAGCAG | GAGGTGAAGGACACAGTGGATGGGCAG    c.1800
 C  H  L  K  T  I  S  S  L  K  Q   | E  V  K  D  T  V  D  G  Q      p.600

          .         .         . | 21       .         .         .    g.25979
 AGGATCCTGGAGAAGAAGGGCAGTGCTGCG | CTCAAGGACCTCAAGCGGCAGCTGCATTTG    c.1860
 R  I  L  E  K  K  G  S  A  A   | L  K  D  L  K  R  Q  L  H  L      p.620

          .         .         .         .         .         .       g.26039
 GAGCGGAAACGGGCAGATAAGCTGCAGGAGCGACTGCAGGACATCCTCACTAACAGCAAG       c.1920
 E  R  K  R  A  D  K  L  Q  E  R  L  Q  D  I  L  T  N  S  K         p.640

          . | 22       .         .         .         .         .    g.28878
 AGCCGCTCAG | GCCTTGAGGAGCTGGTTCTCTCAGAGATGAACTCACCAAGCCGGACCCAG    c.1980
 S  R  S  G |   L  E  E  L  V  L  S  E  M  N  S  P  S  R  T  Q      p.660

          .         .         .         .         .         .       g.28938
 ACAGGGGACAGCAGTAGCATCTCCTCCTTCAGCTACCGGGAGATCTTGCGGGAAAAGGAG       c.2040
 T  G  D  S  S  S  I  S  S  F  S  Y  R  E  I  L  R  E  K  E         p.680

          .         .  | 23      .         .         .         .    g.30939
 AGCTCGGCTGTTCCAGCCAGG | TCCTTATCCAGCAGCCCTCAAGCCCAGCCCCCTCGGCCA    c.2100
 S  S  A  V  P  A  R   | S  L  S  S  S  P  Q  A  Q  P  P  R  P      p.700

          .         .         .         .         .         .       g.30999
 GCAGAGCTGTCAGATGAGGAAGTGGCTGAGCTCTTTCAGCGGCTGGCAGAGACACAGCAG       c.2160
 A  E  L  S  D  E  E  V  A  E  L  F  Q  R  L  A  E  T  Q  Q         p.720

          .         .     | 24   .         .         .         .    g.31188
 GAGAAATGGATGCTGGAGGAGAAG | GTGAAGCACCTGGAAGTGAGCAGTGCTTCCATGGCA    c.2220
 E  K  W  M  L  E  E  K   | V  K  H  L  E  V  S  S  A  S  M  A      p.740

          .         .         .         .         .         | 25    g.31956
 GAGGACCTCTGCCGGAAGAGCGCCATCATTGAGACCTACGTCATGGACAGCCGGATCG | AT    c.2280
 E  D  L  C  R  K  S  A  I  I  E  T  Y  V  M  D  S  R  I  D |       p.760

          .         .         .         .         .         .       g.32016
 GTGTCTGTGGCAGCAGGCCACACAGACCGCAGCGGGCTGGGCAGCGTCCTGAGAGACCTA       c.2340
 V  S  V  A  A  G  H  T  D  R  S  G  L  G  S  V  L  R  D  L         p.780

          .         .         .         .         .         .       g.32076
 GTGAAGCCAGGCGACGAGAACCTTCGGGAGATGAACAAGAAGCTGCAGAACATGCTGGAG       c.2400
 V  K  P  G  D  E  N  L  R  E  M  N  K  K  L  Q  N  M  L  E         p.800

          .         .         .    | 26    .         .         .    g.33005
 GAGCAGCTCACCAAGAATATGCACTTGCACAAG | GATATGGAAGTTCTGTCCCAGGAAATT    c.2460
 E  Q  L  T  K  N  M  H  L  H  K   | D  M  E  V  L  S  Q  E  I      p.820

          .         .         .         .         .         .       g.33065
 GTGCGGCTCAGCAAGGAGTGCGTGGGGCCTCCTGACCCAGACCTAGAGCCAGGAGAAACC       c.2520
 V  R  L  S  K  E  C  V  G  P  P  D  P  D  L  E  P  G  E  T         p.840

                                                                    g.33071
 AGCTAA                                                             c.2526
 S  X                                                               p.841

          .         .         .         .         .         .       g.33131
 agacctgcaggctgcacccacctcctccccttcctaccccctaggatgctattcccttgg       c.*60

          .         .         .         .         .         .       g.33191
 gctgtggtggaaaaatgagggctggagccaaaatcaaatagcttgggagactggacatta       c.*120

          .         .         .         .         .         .       g.33251
 aaggggctagaggcctgatggttagtgttaatgatcctgtcttagggcagaggccaccag       c.*180

          .         .         .         .         .         .       g.33311
 ggagtggggatcctgagggaaggggcagggatttctccttcttcttggtcctggctccca       c.*240

          .         .         .         .         .         .       g.33371
 agggcttctgtcttcatctctgcatgagctctccttcccagagaccaactcttttttatt       c.*300

          .         .         .         .         .         .       g.33431
 ttattttattttattttttaatttatgtctggagcctggctactctgcatttgggattgg       c.*360

          .         .         .         .         .         .       g.33491
 ggatgctgggtgggtgtgtggtccatgttcagcgttctagcaacacgtgtgtgtgtgtgt       c.*420

          .         .         .         .         .                 g.33542
 gtgtaaaggctatgcagccaaaataccatctggccagacgggcccacccac                c.*471

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The GRIP1 associated protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center