glycophorin B (MNS blood group) (GYPB) - coding DNA reference sequence

(used for variant description)

(last modified December 17, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_002100.4 in the GYPB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007483.2, covering GYPB transcript NM_002100.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5056
     agttgtctttggtagtttttttgcactaacttcaggaaccagctcatgatctcagg       c.-1

          .         .         .        | 02.         .         .    g.23083
 ATGTATGGAAAAATAATCTTTGTATTACTATTGTCAG | AAATTGTGAGCATATCAGCATTA    c.60
 M  Y  G  K  I  I  F  V  L  L  L  S  E |   I  V  S  I  S  A  L      p.20

          .         .         .         .         .         .       g.23143
 AGTACCACTGAGGTGGCAATGCACACTTCAACCTCTTCTTCAGTCACAAAGAGTTACATC       c.120
 S  T  T  E  V  A  M  H  T  S  T  S  S  S  V  T  K  S  Y  I         p.40

          .       | 03 .         .         .         .      | 04  . g.26714
 TCATCACAGACAAATG | GAGAAACGGGACAACTTGTCCATCGTTTCACTGTACCAG | CTCCT c.180
 S  S  Q  T  N  G |   E  T  G  Q  L  V  H  R  F  T  V  P  A |   P   p.60

          .         .         .         .         .         .       g.26774
 GTAGTGATAATACTCATTATTTTGTGTGTGATGGCTGGTATTATTGGAACGATCCTCTTA       c.240
 V  V  I  I  L  I  I  L  C  V  M  A  G  I  I  G  T  I  L  L         p.80

          .         .         . | 05                                g.28069
 ATTTCTTACACTATTCGCCGACTGATAAAG | GCATGA                            c.276
 I  S  Y  T  I  R  R  L  I  K   | A  X                              p.91

          .         .         .         .         .         .       g.28129
 ggatgtggcctgcatgctgcctgatcttgcctagaaccggctgcacctgctgttctcttg       c.*60

          .         .         .         .         .         .       g.28189
 tttatgcaaactggctgcacctgctattcctttgcttatgcccctacccctggctatcct       c.*120

          .         .         .         .         .         .       g.28249
 aattccctgttctcctgcctcactattactgtattctctacttctaaataaaaataaaac       c.*180

          .                                                         g.28264
 aaaatacaaaccgtt                                                    c.*195

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Glycophorin B (MNS blood group) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.