H3 histone, family 3A (H3F3A) - coding DNA reference sequence

(used for variant description)

(last modified November 18, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_002107.4 in the H3F3A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering H3F3A transcript NM_002107.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5008
                                                     gtcagcca       c.-121

 .         .         .         .         .         .                g.5068
 tctttcaattgtgttcgcagccgccgccgcgccgccgtcgctctccaacgccagcgccgc       c.-61

 .         .         .         .       | 02 .         .             g.6645
 ctctcgctcgccgagctccagccgaaggagaaggggg | gtaagtaaggaggtctctgtacc    c.-1

          .         .         .         .         .         .       g.6705
 ATGGCTCGTACAAAGCAGACTGCCCGCAAATCGACCGGTGGTAAAGCACCCAGGAAGCAA       c.60
 M  A  R  T  K  Q  T  A  R  K  S  T  G  G  K  A  P  R  K  Q         p.20

          .         .         .         .         .         .       g.6765
 CTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCAT       c.120
 L  A  T  K  A  A  R  K  S  A  P  S  T  G  G  V  K  K  P  H         p.40

          | 03         .         .         .         .         .    g.8001
 CGTTACAG | GCCTGGTACTGTGGCGCTCCGTGAAATTAGACGTTATCAGAAGTCCACTGAA    c.180
 R  Y  R  |  P  G  T  V  A  L  R  E  I  R  R  Y  Q  K  S  T  E      p.60

          .         .         .         .         .         .       g.8061
 CTTCTGATTCGCAAACTTCCCTTCCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTTAAA       c.240
 L  L  I  R  K  L  P  F  Q  R  L  V  R  E  I  A  Q  D  F  K         p.80

          .         .         .         .   | 04     .         .    g.13662
 ACAGATCTGCGCTTCCAGAGCGCAGCTATCGGTGCTTTGCAG | GAGGCAAGTGAGGCCTAT    c.300
 T  D  L  R  F  Q  S  A  A  I  G  A  L  Q   | E  A  S  E  A  Y      p.100

          .         .         .         .         .         .       g.13722
 CTGGTTGGCCTTTTTGAAGACACCAACCTGTGTGCTATCCATGCCAAACGTGTAACAATT       c.360
 L  V  G  L  F  E  D  T  N  L  C  A  I  H  A  K  R  V  T  I         p.120

          .         .         .         .         .                 g.13773
 ATGCCAAAAGACATCCAGCTAGCACGCCGCATACGTGGAGAACGTGCTTAA                c.411
 M  P  K  D  I  Q  L  A  R  R  I  R  G  E  R  A  X                  p.136

          .         .         .         .         .         .       g.13833
 gaatccactatgatgggaaacatttcattctcaaaaaaaaaaaaaaaaatttctcttctt       c.*60

          .         .         .         .         .         .       g.13893
 cctgttattggtagttctgaacgttagatattttttttccatggggtcaaaaggtaccta       c.*120

          .         .         .         .         .         .       g.13953
 agtatatgattgcgagtggaaaaataggggacagaaatcaggtattggcagtttttccat       c.*180

          .         .         .         .         .         .       g.14013
 tttcatttgtgtgtgaatttttaatataaatgcggagacgtaaagcattaatgcaagtta       c.*240

          .         .         .         .         .         .       g.14073
 aaatgtttcagtgaacaagtttcagcggttcaactttataataattataaataaacctgt       c.*300

          .         .         .         .         .         .       g.14133
 taaatttttctggacaatgccagcatttggatttttttaaaacaagtaaatttcttattg       c.*360

          .         .         .         .         .         .       g.14193
 atggcaactaaatggtgtttgtagcatttttatcatacagtagattccatccattcacta       c.*420

          .         .         .         .         .         .       g.14253
 tacttttctaactgagttgtcctacatgcaagtacatgtttttaatgttgtctgtcttct       c.*480

          .         .         .         .                           g.14296
 gtgctgttcctgtaagtttgctattaaaatacattaaactata                        c.*523

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The H3 histone, family 3A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.