H3 histone, family 3B (H3.3B) (H3F3B) - coding DNA reference sequence

(used for variant description)

(last modified December 24, 2023)


This file was created to facilitate the description of sequence variants on transcript NM_005324.3 in the H3F3B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering H3F3B transcript NM_005324.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5013
                                                gagcgcagagcgg       c.-121

 .         .         .         .         .         .                g.5073
 tttggtcgttcgttgggcggtgctggtttttcgctcgtcgactgcggctcttcctcgggc       c.-61

 .         .         .         .         .          | 02            g.5605
 agcggaagcggcgcggcggtcggagaagtggcctaaaacttcggcgttgg | gtgaaagaaa    c.-1

          .         .         .         .         .         .       g.5665
 ATGGCCCGAACCAAGCAGACTGCTCGTAAGTCCACCGGTGGGAAAGCCCCCCGCAAACAG       c.60
 M  A  R  T  K  Q  T  A  R  K  S  T  G  G  K  A  P  R  K  Q         p.20

          .         .         .         .         .         .       g.5725
 CTGGCCACGAAAGCCGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAGAAGCCTCAT       c.120
 L  A  T  K  A  A  R  K  S  A  P  S  T  G  G  V  K  K  P  H         p.40

          | 03         .         .         .         .         .    g.5868
 CGCTACAG | GCCCGGGACCGTGGCGCTTCGAGAGATTCGTCGTTATCAGAAGTCGACCGAG    c.180
 R  Y  R  |  P  G  T  V  A  L  R  E  I  R  R  Y  Q  K  S  T  E      p.60

          .         .         .         .         .         .       g.5928
 CTGCTCATCCGGAAGCTGCCCTTCCAGAGGTTGGTGAGGGAGATCGCGCAGGATTTCAAA       c.240
 L  L  I  R  K  L  P  F  Q  R  L  V  R  E  I  A  Q  D  F  K         p.80

          .         .         .         .   | 04     .         .    g.6074
 ACCGACCTGAGGTTTCAGAGCGCAGCCATCGGTGCGCTGCAG | GAGGCTAGCGAAGCGTAC    c.300
 T  D  L  R  F  Q  S  A  A  I  G  A  L  Q   | E  A  S  E  A  Y      p.100

          .         .         .         .         .         .       g.6134
 CTGGTGGGTCTGTTCGAAGATACCAACCTGTGTGCCATCCACGCTAAGAGAGTCACCATC       c.360
 L  V  G  L  F  E  D  T  N  L  C  A  I  H  A  K  R  V  T  I         p.120

          .         .         .         .         .                 g.6185
 ATGCCCAAAGACATCCAGTTGGCTCGCCGGATACGGGGAGAGAGAGCTTAA                c.411
 M  P  K  D  I  Q  L  A  R  R  I  R  G  E  R  A  X                  p.136

          .         .         .         .         .         .       g.6245
 gtgaaggcagtttttatggcgttttgtagtaaattctgtaaaatactttggtttaatttg       c.*60

          .         .         .         .         .         .       g.6305
 tgactttttttgtaagaaattgtttataatatgttgcatttgtacttaagtcattccatc       c.*120

          .         .         .         .         .         .       g.6365
 tttcactcaggatgaatgcgaaaagtgactgttcacagacctcagtgatgtgagcactgt       c.*180

          .         .         .         .         .         .       g.6425
 tgctcaggagtgacaagttgctaatatgcagaagggatgggtgatacttcttgcttctca       c.*240

          .         .         .         .         .         .       g.6485
 tgatgcatgtttctgtatgttaatgacttgttgggtagctattaaggtactagagttgat       c.*300

          .         .         .         .         .         .       g.6545
 aaatgtgtacagggtccttttgcaataaaactggttatgacttgatccaagtgtttaaca       c.*360

          .         .         .         .         .         .       g.6605
 attggggctgttaagtctgaccatacatcactgtgatagaatgtgggctttttcaagggt       c.*420

          .         .         .         .         .         .       g.6665
 gaagatacaagtcttaaccacagtgtaacttacagtttcctttaaaaaaaaaaaaagtaa       c.*480

          .         .         .         .         .         .       g.6725
 acctggcagctatagaatacactatgtgcatttataatagctattttatatattgtagta       c.*540

          .         .         .         .         .         .       g.6785
 tcaacatttttaaattaaatgttttacattcacaagtggtggggagtcttgtcattaagg       c.*600

          .         .         .         .         .         .       g.6845
 tgtgtgtaatttagagtccagttggttttcttctgactgcacttgttctcatagtagtaa       c.*660

          .         .         .         .         .         .       g.6905
 aatgctatgcgcatttataccttgcataagtcctcattctaccacatgttaaccctctag       c.*720

          .         .         .         .         .         .       g.6965
 ctgataatgcaaacactaactgggggattttatttataagggctctagaaaaaacgagtt       c.*780

          .         .         .         .         .         .       g.7025
 attcacaccagcatcatcttaactaacattctgaactagttagtgcagcttttcattgtg       c.*840

          .         .         .         .         .         .       g.7085
 ttgtgtggttggtctcataactaggttgagtttttctcctctgctgaggaaacagtaccg       c.*900

          .         .         .         .         .         .       g.7145
 aagttctttttcttgtggcatttgtattataaaaacttggtgtgggggaggagcacaaaa       c.*960

          .         .         .         .         .         .       g.7205
 ctccagcccactgaacctctgccaattaagatggtgttgggttaggttacatctggttac       c.*1020

          .         .         .         .         .         .       g.7265
 tgtcctgggaaaatcatttttatagagatggccttccaagtggttttaaaatttactgaa       c.*1080

          .         .         .         .         .         .       g.7325
 gtttttaggtcaattatgtatgttgactaaatttacaaataaacttgtttatccaactaa       c.*1140

          .         .         .         .         .         .       g.7385
 gtgtccaaaacctaaattgaatgtactaagttttcacatgtcccattatctaggtccttg       c.*1200

          .         .         .         .         .         .       g.7445
 tatactaatgttttgaacttagatcatttcaggtgttgtttggtggataaaggaaccttt       c.*1260

          .         .         .         .         .         .       g.7505
 tatttataaagatactgtagaaagcatgtgaacagctctctgcttgattaagatgccata       c.*1320

          .         .         .         .         .         .       g.7565
 atagtgctgtatttgcagtgtgggctaagacaaagtatattaataagcttttcagccccc       c.*1380

          .         .         .         .         .         .       g.7625
 ccactcccgttccgtagtgtagaagcccacaggtgtagaactcagtcttaaacttcagta       c.*1440

          .         .         .         .         .         .       g.7685
 tgaaaccagtttccttgtgcgatgatggccactaaagcatagtacgtggatgtcagtgag       c.*1500

          .         .         .         .         .         .       g.7745
 acagcatgagagccagcagtcatcaaagcgttccacgtttgaagttagcaactgcttaaa       c.*1560

          .         .         .         .         .         .       g.7805
 gttataccccattaaaattgctttctcaaaagtttgggttagtttcaaatgtgatatttt       c.*1620

          .         .         .         .         .         .       g.7865
 ggagggaaggtaaagtaggtatctttcaggtcgtgataatgagctcctatgaaaggatgc       c.*1680

          .         .         .         .         .         .       g.7925
 aatataatgacccgcttttctagaaagttcataatcagctctggaacaagcacacttgat       c.*1740

          .         .         .         .         .         .       g.7985
 tcctcactgtgcttcagaatgagattaagatcagatgttggaacgtgctatgctgtagcg       c.*1800

          .         .         .         .         .         .       g.8045
 tgtctggaaacaaagtacacaaacctggctacggtgatgagttagcttctgcttactacc       c.*1860

          .         .         .         .         .         .       g.8105
 tgtgacaacccaagtgggtgacactagtgaaccttctccagtctgcaggctggcatagaa       c.*1920

          .         .         .         .         .         .       g.8165
 ggctcttagattatattgggcagcttgcaatctgccgaagcagtgacttgcatttccaca       c.*1980

          .         .         .         .         .         .       g.8225
 cttggcttgagcactcaacccagaaggcgaagatagcttttggttgtaggcggcttcctg       c.*2040

          .         .         .         .         .         .       g.8285
 tatgggatatccctcggtaagggtaaaggagcagaggcaaaggagaaaagcagaagttgc       c.*2100

          .         .         .         .         .         .       g.8345
 agctgatgcaggtatcctatgcccttgatggatgagactaaaataaaatttttgaagtta       c.*2160

                                                                    g.8346
 a                                                                  c.*2161

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The H3 histone, family 3B (H3.3B) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 29
©2004-2023 Leiden University Medical Center