hepcidin antimicrobial peptide (HAMP) - coding DNA reference sequence

(used for variant description)

(last modified November 24, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_021175.2 in the HAMP gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011563.1, covering HAMP transcript NM_021175.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5011
                                                  gactgtcactc       c.-61

 .         .         .         .         .         .                g.5071
 ggtcccagacaccagagcaagctcaagacccagcagtgggacagccagacagacggcacg       c.-1

          .         .         .         .         .         .       g.5131
 ATGGCACTGAGCTCCCAGATCTGGGCCGCTTGCCTCCTGCTCCTCCTCCTCCTCGCCAGC       c.60
 M  A  L  S  S  Q  I  W  A  A  C  L  L  L  L  L  L  L  A  S         p.20

          .         .         . | 02       .         .         .    g.7312
 CTGACCAGTGGCTCTGTTTTCCCACAACAG | ACGGGACAACTTGCAGAGCTGCAACCCCAG    c.120
 L  T  S  G  S  V  F  P  Q  Q   | T  G  Q  L  A  E  L  Q  P  Q      p.40

          .         .         . | 03       .         .         .    g.7461
 GACAGAGCTGGAGCCAGGGCCAGCTGGATG | CCCATGTTCCAGAGGCGAAGGAGGCGAGAC    c.180
 D  R  A  G  A  R  A  S  W  M   | P  M  F  Q  R  R  R  R  R  D      p.60

          .         .         .         .         .         .       g.7521
 ACCCACTTCCCCATCTGCATTTTCTGCTGCGGCTGCTGTCATCGATCAAAGTGTGGGATG       c.240
 T  H  F  P  I  C  I  F  C  C  G  C  C  H  R  S  K  C  G  M         p.80

          .                                                         g.7536
 TGCTGCAAGACGTAG                                                    c.255
 C  C  K  T  X                                                      p.84

          .         .         .         .         .         .       g.7596
 aacctacctgccctgcccccgtcccctcccttccttatttattcctgctgccccagaaca       c.*60

          .         .         .         .                           g.7637
 taggtcttggaataaaatggctggttcttttgttttccaaa                          c.*101

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Hepcidin antimicrobial peptide protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.