heart and neural crest derivatives expressed 2 (HAND2) - coding DNA reference sequence

(used for variant description)

(last modified February 10, 2026)

This file was created to facilitate the description of sequence variants on transcript NM_021973.2 in the HAND2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000004.11, covering HAND2 transcript NM_021973.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5038
                       ctgtacatggagatcttgctgggaaaatccgcttgctc       c.-901

 .         .         .         .         .         .                g.5098
 ccctcacgtcgtccagcccaggagaaccaccgccgtcaccccggagcttcctcggccacc       c.-841

 .         .         .         .         .         .                g.5158
 gcgcagagccctccgagagcccgagccgcggtcttcgagctccaaggctcattcagggcc       c.-781

 .         .         .         .         .         .                g.5218
 ccagatccttgccccgaaaggagaggatctgagaaaatggatgcactgagacctctctga       c.-721

 .         .         .         .         .         .                g.5278
 aaaccctccgagagagcgcgagaggagcgaggacacgttactcgcagctaaaatcacatt       c.-661

 .         .         .         .         .         .                g.5338
 taaggaccaaaacaacaacaaccaaaaatttcattaaaacaataagcgcccaagaaccca       c.-601

 .         .         .         .         .         .                g.5398
 gatcgggctggtggggggaggggaagaggcgggaaggggagggtcgcacggaggtagctt       c.-541

 .         .         .         .         .         .                g.5458
 tgcagtgagcagtcgaccccgccgccccccggcacagctggaccggctcctccagccgcg       c.-481

 .         .         .         .         .         .                g.5518
 gctcagactcgcccctggattccgggttagcttcggtgccaggaccgcggcccgggcttg       c.-421

 .         .         .         .         .         .                g.5578
 gattcccgagactccgcgtaccagcctcgcgggagccccggcacctttgtatgagcacga       c.-361

 .         .         .         .         .         .                g.5638
 gaggattctgcctccgcgcagcagcccgggaagcaggagccgaagcgcgggccgtggagc       c.-301

 .         .         .         .         .         .                g.5698
 aaggcgggaaccggaggcggcggcggcggcggccaggggcgcacggtgccaggaccagct       c.-241

 .         .         .         .         .         .                g.5758
 cgccgcgccccatggggagccggcggccgcagcgctgctgaggcgggcccggctggccag       c.-181

 .         .         .         .         .         .                g.5818
 gcggggggacggggcccgggctgcagcagccccctctgcggctgccgggcgggcccgggc       c.-121

 .         .         .         .         .         .                g.5878
 gcccgggggctggggggtggggggtgggggaggacgccgagcgctgaggcaggggcccgg       c.-61

 .         .         .         .         .         .                g.5938
 gccgagggcgcggcggggctgcgcgcacgctggggcgcgtggaggggcgcggagggcgaa       c.-1

          .         .         .         .         .         .       g.5998
 ATGAGTCTGGTAGGTGGTTTTCCCCACCACCCGGTGGTGCACCACGAGGGCTACCCGTTT       c.60
 M  S  L  V  G  G  F  P  H  H  P  V  V  H  H  E  G  Y  P  F         p.20

          .         .         .         .         .         .       g.6058
 GCCGCCGCCGCCGCCGCAGCTGCCGCCGCCGCCGCCAGCCGCTGCAGCCATGAGGAGAAC       c.120
 A  A  A  A  A  A  A  A  A  A  A  A  S  R  C  S  H  E  E  N         p.40

          .         .         .         .         .         .       g.6118
 CCCTACTTCCATGGCTGGCTCATCGGCCACCCCGAGATGTCGCCCCCCGACTACAGCATG       c.180
 P  Y  F  H  G  W  L  I  G  H  P  E  M  S  P  P  D  Y  S  M         p.60

          .         .         .         .         .         .       g.6178
 GCCCTGTCCTACAGCCCCGAGTATGCCAGCGGCGCCGCCGGCCTGGACCACTCCCATTAC       c.240
 A  L  S  Y  S  P  E  Y  A  S  G  A  A  G  L  D  H  S  H  Y         p.80

          .         .         .         .         .         .       g.6238
 GGGGGGGTGCCGCCGGGCGCCGGGCCCCCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGC       c.300
 G  G  V  P  P  G  A  G  P  P  G  L  G  G  P  R  P  V  K  R         p.100

          .         .         .         .         .         .       g.6298
 CGAGGCACCGCCAACCGCAAGGAGCGGCGCAGGACTCAGAGCATCAACAGCGCCTTCGCC       c.360
 R  G  T  A  N  R  K  E  R  R  R  T  Q  S  I  N  S  A  F  A         p.120

          .         .         .         .         .         .       g.6358
 GAACTGCGCGAGTGCATCCCCAACGTACCCGCCGACACCAAACTCTCCAAAATCAAGACC       c.420
 E  L  R  E  C  I  P  N  V  P  A  D  T  K  L  S  K  I  K  T         p.140

          .         .         .         .         .         .       g.6418
 CTGCGCCTGGCCACCAGCTACATCGCCTACCTCATGGACCTGCTGGCCAAGGACGACCAG       c.480
 L  R  L  A  T  S  Y  I  A  Y  L  M  D  L  L  A  K  D  D  Q         p.160

          .         .         .         .         .         .       g.6478
 AATGGCGAGGCGGAGGCCTTCAAGGCAGAGATCAAGAAGACCGACGTGAAAGAGGAGAAG       c.540
 N  G  E  A  E  A  F  K  A  E  I  K  K  T  D  V  K  E  E  K         p.180

          .      | 02  .         .         .         .         .    g.7897
 AGGAAGAAGGAGCTG | AACGAAATCTTGAAAAGCACAGTGAGCAGCAACGACAAGAAAACC    c.600
 R  K  K  E  L   | N  E  I  L  K  S  T  V  S  S  N  D  K  K  T      p.200

          .         .         .         .         .                 g.7951
 AAAGGCCGGACGGGCTGGCCGCAGCACGTCTGGGCCCTGGAGCTCAAGCAGTGA             c.654
 K  G  R  T  G  W  P  Q  H  V  W  A  L  E  L  K  Q  X               p.217

          .         .         .         .         .         .       g.8011
 ggaggaggagaaggaggaggaggagagcgcgagtgagcaggggccaaggcgccagatgca       c.*60

          .         .         .         .         .         .       g.8071
 gacccaggactccggaaaagccgtccgcgctccgctctgaggactccttgcatttggaat       c.*120

          .         .         .         .         .         .       g.8131
 catccggtttatttatgtgcaatttccttcccctctctttgaccccctttgaggcatctg       c.*180

          .         .         .         .         .         .       g.8191
 ctccccgtctccccctccaaaaaaaaagtggatatttgaagaaaagcattccatatttta       c.*240

          .         .         .         .         .         .       g.8251
 atacgaagaggacactcccgtgtggtaagggatcccgtcgtctcatagattctgtgtgcg       c.*300

          .         .         .         .         .         .       g.8311
 tgaatgttccctcttggctgtgtagacaccagcgttgccccccgccaacctactcaaccc       c.*360

          .         .         .         .         .         .       g.8371
 cttccagataaagacagtgggcactagtgcgtttgtgaagtgtatctttaatacttggcc       c.*420

          .         .         .         .         .         .       g.8431
 tttggatataaatattcctgggtattataaagttttatttcaaagcagaaaacagggccg       c.*480

          .         .         .         .         .         .       g.8491
 ctaacatttccgttggggtcggtatctagtgctatccattcatctgtggtcgttccctct       c.*540

          .         .         .         .         .         .       g.8551
 ttgaagatgtttccaacagccacttgttttgtgcacttccgtcctctaaaactaaatgga       c.*600

          .         .         .         .         .         .       g.8611
 atttaattaatattgaaggtgtaaacgttgtaagtattcaataaaccactgtgttttttt       c.*660

          .         .         .         .         .         .       g.8671
 tttacaaaaaccttaatcttttaatggctgatacctcaaaagagttttgaaaacaaagct       c.*720

          .         .         .         .         .                 g.8727
 gttatacttgttttcgtaatatttaaaatattcagaagtaaactaaattatcatga           c.*776

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Heart and neural crest derivatives expressed 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.