HAUS augmin-like complex, subunit 7 (HAUS7) - coding DNA reference sequence

(used for variant description)

(last modified December 12, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_017518.6 in the HAUS7 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012688.1, covering HAUS7 transcript NM_017518.6.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5018
                                           cgtgagcatggtgaagag       c.-541

 .         .         .         .         .         .                g.5078
 aagacggagccccgcgctgggagaggaacgcttcagtccgagttccattctgcacccaag       c.-481

 .         .         .         .         .         .                g.5138
 gctccccttggtcctcctgggaaccagggtgccccttagtggtggtggcccaggagaacc       c.-421

 .         .         .         .         .         .                g.5198
 cgaccaaggcaggagcgccccctcctggaagagcctcgcttcaacgcatcatcattcccg       c.-361

 .         .         .         .         .         .                g.5258
 gccggcagcaggggcgacgccagcaaggcctgcgactcagagccagcttggcccgttcgc       c.-301

 .         .         .         .         .         .                g.5318
 cccgccccttcccggtgtccgccccgcccctttcccggtgtccgccccgcctccttcccg       c.-241

 .         .         .         .         .         .                g.5378
 gtgtccgccccgcccccttccctgtgtccgccccgcccccttccctgtgtccgccctgcc       c.-181

 .         .         .         .         .         .                g.5438
 cgcttcactgtggtcctgcctctgggtggtgccggggcggggggtgggagcccggggccc       c.-121

 .         .         .         .         .         .                g.5498
 gcgcaggcggagatgtcgcccaatgggaagggtcggtcgggaagggggtgggcgcaggcg       c.-61

 .         .         .         .         .         .                g.5558
 ggtgggcgggaagaacgctggaggttgattggcggtcttgccggccagtgaagccagggc       c.-1

          .         .         .         .         .         .       g.5618
 ATGGGCGGGGCGCGGCTCGGAGCGCGAAACATGGCGGGGCAGGACGCTGGCTGCGGCCGT       c.60
 M  G  G  A  R  L  G  A  R  N  M  A  G  Q  D  A  G  C  G  R         p.20

          .         .         .         .         .         .       g.5678
 GGCGGCGACGACTACTCAGAGGACGAGGGCGACAGCAGCGTGTCCAGGGCGGCTGTGGAG       c.120
 G  G  D  D  Y  S  E  D  E  G  D  S  S  V  S  R  A  A  V  E         p.40

          .         | 02         .         .         .         .    g.6926
 GTGTTCGGGAAGCTGAAG | GACCTAAACTGCCCCTTCCTCGAGGGTCTGTATATCACAGAG    c.180
 V  F  G  K  L  K   | D  L  N  C  P  F  L  E  G  L  Y  I  T  E      p.60

          .         .         .         .         .         .       g.6986
 CCAAAGACAATTCAGGAACTGCTGTGCAGCCCCTCAGAGTACCGCTTGGAGATCCTAGAG       c.240
 P  K  T  I  Q  E  L  L  C  S  P  S  E  Y  R  L  E  I  L  E         p.80

          .     | 03   .         .         .         .         .    g.11136
 TGGATGTGTACCCG | GGTCTGGCCCTCACTGCAGGACAGGTTCAGCTCACTGAAAGGGGTC    c.300
 W  M  C  T  R  |  V  W  P  S  L  Q  D  R  F  S  S  L  K  G  V      p.100

          .         .   | 04     .         .         .         .    g.13512
 CCAACAGAGGTGAAGATCCAAG | AAATGACGAAGCTGGGCCACGAGCTGATGCTGTGTGCG    c.360
 P  T  E  V  K  I  Q  E |   M  T  K  L  G  H  E  L  M  L  C  A      p.120

          .         .     | 05   .         .         .         .    g.18953
 CCAGATGACCAGGAGCTCCTCAAG | GGCTGTGCCTGCGCCCAGAAGCAGCTACACTTCATG    c.420
 P  D  D  Q  E  L  L  K   | G  C  A  C  A  Q  K  Q  L  H  F  M      p.140

          .         .         .         .         .       | 06 .    g.19498
 GACCAGTTGCTCGATACCATCCGGAGCCTGACCATTGGGTGCTCCAGTTGCTCGAG | CCTG    c.480
 D  Q  L  L  D  T  I  R  S  L  T  I  G  C  S  S  C  S  S  |  L      p.160

          .         .         .         .         .         .       g.19558
 ATGGAGCACTTCGAGGACACCAGGGAGAAGAACGAGGCCTTGCTGGGGGAGCTCTTCTCT       c.540
 M  E  H  F  E  D  T  R  E  K  N  E  A  L  L  G  E  L  F  S         p.180

          .         .         .         .         .         .       g.19618
 AGCCCCCACCTGCAGATGCTCCTGAATCCAGAGTGCGACCCGTGGCCCCTGGACATGCAG       c.600
 S  P  H  L  Q  M  L  L  N  P  E  C  D  P  W  P  L  D  M  Q         p.200

          .         .         .      | 07  .         .         .    g.19806
 CCCCTCCTCAACAAGCAGAGTGATGACTGGCAGTG | GGCCAGTGCCTCTGCCAAGTCCGAG    c.660
 P  L  L  N  K  Q  S  D  D  W  Q  W  |  A  S  A  S  A  K  S  E      p.220

          .         .         .         .         .         .       g.19866
 GAGGAGGAGAAGCTGGCGGAGCTTGCCAGGCAGCTGCAGGAGAGTGCTGCCAAGTTGCAC       c.720
 E  E  E  K  L  A  E  L  A  R  Q  L  Q  E  S  A  A  K  L  H         p.240

          .      | 08  .         .         .         .         .    g.20424
 GCGCTTAGAACGGAG | TACTTTGCACAGCATGAGCAAGGGGCTGCTGCGGGCGCAGCCGAC    c.780
 A  L  R  T  E   | Y  F  A  Q  H  E  Q  G  A  A  A  G  A  A  D      p.260

          .         .         .         .         .         .       g.20484
 ATCAGCACCCTAGACCAGAAGCTGCGTCTGGTCACTTCCGACTTCCACCAGCTAATCTTG       c.840
 I  S  T  L  D  Q  K  L  R  L  V  T  S  D  F  H  Q  L  I  L         p.280

          .         .         .         .         .         .       g.20544
 GCTTTTCTCCAAGTCTACGACGACGAGCTGGGCGAGTGCTGCCAGCGCCCAGGCCCTGAC       c.900
 A  F  L  Q  V  Y  D  D  E  L  G  E  C  C  Q  R  P  G  P  D         p.300

          .         .         .         .         .         .       g.20604
 CTCCACCCGTGCGGCCCCATCATCCAGGCCACGCACCAGAATCTGACTTCCTACAGCCAA       c.960
 L  H  P  C  G  P  I  I  Q  A  T  H  Q  N  L  T  S  Y  S  Q         p.320

  | 09       .         .         .         .         .         .    g.21697
  | CTGCTGCAAGTGGTCATGGCAGTTGCTGACACCTCTGCGAAGGCCGTGGAGACCGTGAAG    c.1020
  | L  L  Q  V  V  M  A  V  A  D  T  S  A  K  A  V  E  T  V  K      p.340

          .         .         .         .         .      | 10  .    g.28241
 AAGCAGCAAGGCGAGCAGATCTGCTGGGGTGGCAGCAGCTCCGTCATGAGTCTAG | CTACC    c.1080
 K  Q  Q  G  E  Q  I  C  W  G  G  S  S  S  V  M  S  L  A |   T      p.360

          .         .                                               g.28268
 AAGATGAATGAACTAATGGAGAAATAG                                        c.1107
 K  M  N  E  L  M  E  K  X                                          p.368

          .         .         .         .         .         .       g.28328
 aaagtcttcagtgatggcctacgccaaagcacaggatggggcgggcaggaagccctctcc       c.*60

          .         .         .         .         .         .       g.28388
 caagatcgagttggccgaggatggatgattgtggcagcagaagccgttgcagccccacgt       c.*120

          .         .         .         .         .         .       g.28448
 tgtgctctaggcagggacctttggcccctttggggagggagagacagacgggcggtttga       c.*180

          .         .         .                                     g.28481
 cttggacacaaagaaagccttggtttctaagca                                  c.*213

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The HAUS augmin-like complex, subunit 7 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2014 Leiden University Medical Center