hemoglobin, alpha 1 (HBA1) - coding DNA reference sequence

(used for variant description)

(last modified August 20, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_000558.3 in the HBA1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_000006.1, covering HBA1 transcript NM_000558.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.37579
                        actcttctggtccccacagactcagagagaacccacc       c.-1

          .         .         .         .         .         .       g.37639
 ATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCG       c.60
 M  V  L  S  P  A  D  K  T  N  V  K  A  A  W  G  K  V  G  A         p.20

          .         .         .      | 02  .         .         .    g.37816
 CACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAG | GATGTTCCTGTCCTTCCCCACCACC    c.120
 H  A  G  E  Y  G  A  E  A  L  E  R  |  M  F  L  S  F  P  T  T      p.40

          .         .         .         .         .         .       g.37876
 AAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGC       c.180
 K  T  Y  F  P  H  F  D  L  S  H  G  S  A  Q  V  K  G  H  G         p.60

          .         .         .         .         .         .       g.37936
 AAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCG       c.240
 K  K  V  A  D  A  L  T  N  A  V  A  H  V  D  D  M  P  N  A         p.80

          .         .         .         .         .         .       g.37996
 CTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAG       c.300
 L  S  A  L  S  D  L  H  A  H  K  L  R  V  D  P  V  N  F  K         p.100

  | 03       .         .         .         .         .         .    g.38205
  | CTCCTAAGCCACTGCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCT    c.360
  | L  L  S  H  C  L  L  V  T  L  A  A  H  L  P  A  E  F  T  P      p.120

          .         .         .         .         .         .       g.38265
 GCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAA       c.420
 A  V  H  A  S  L  D  K  F  L  A  S  V  S  T  V  L  T  S  K         p.140

                                                                    g.38274
 TACCGTTAA                                                          c.429
 Y  R  X                                                            p.142

          .         .         .         .         .         .       g.38334
 gctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctcccc       c.*60

          .         .         .         .         .                 g.38384
 ttcctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggc                 c.*110

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Hemoglobin, alpha 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.