hemoglobin, beta (HBB) - coding DNA reference sequence

(used for variant description)

(last modified October 2, 2013)


This file was created to facilitate the description of sequence variants on transcript NM_000518.4 in the HBB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering HBB transcript NM_000518.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5050
           acatttgcttctgacacaactgtgttcactagcaacctcaaacagacacc       c.-1

          .         .         .         .         .         .       g.5110
 ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAAC       c.60
 M  V  H  L  T  P  E  E  K  S  A  V  T  A  L  W  G  K  V  N         p.20

          .         .         .   | 02     .         .         .    g.5300
 GTGGATGAAGTTGGTGGTGAGGCCCTGGGCAG | GCTGCTGGTGGTCTACCCTTGGACCCAG    c.120
 V  D  E  V  G  G  E  A  L  G  R  |  L  L  V  V  Y  P  W  T  Q      p.40

          .         .         .         .         .         .       g.5360
 AGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAG       c.180
 R  F  F  E  S  F  G  D  L  S  T  P  D  A  V  M  G  N  P  K         p.60

          .         .         .         .         .         .       g.5420
 GTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGAC       c.240
 V  K  A  H  G  K  K  V  L  G  A  F  S  D  G  L  A  H  L  D         p.80

          .         .         .         .         .         .       g.5480
 AACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT       c.300
 N  L  K  G  T  F  A  T  L  S  E  L  H  C  D  K  L  H  V  D         p.100

          .      | 03  .         .         .         .         .    g.6390
 CCTGAGAACTTCAGG | CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGC    c.360
 P  E  N  F  R   | L  L  G  N  V  L  V  C  V  L  A  H  H  F  G      p.120

          .         .         .         .         .         .       g.6450
 AAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT       c.420
 K  E  F  T  P  P  V  Q  A  A  Y  Q  K  V  V  A  G  V  A  N         p.140

          .         .                                               g.6474
 GCCCTGGCCCACAAGTATCACTAA                                           c.444
 A  L  A  H  K  Y  H  X                                             p.147

          .         .         .         .         .         .       g.6534
 gctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaactac       c.*60

          .         .         .         .         .         .       g.6594
 taaactgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatt       c.*120

          .                                                         g.6606
 tattttcattgc                                                       c.*132

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Hemoglobin, beta protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 07c
©2004-2013 Leiden University Medical Center