hemoglobin, mu (HBM) - coding DNA reference sequence

(used for variant description)

(last modified April 11, 2024)

This file was created to facilitate the description of sequence variants on transcript NM_001003938.3 in the HBM gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering HBM transcript NM_001003938.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5024
                                     ccccagagcacgtcaggcggcgcc       c.-1

          .         .         .         .         .         .       g.5084
 ATGCTCAGCGCCCAGGAGCGCGCCCAAATCGCGCAGGTCTGGGACCTGATTGCGGGCCAC       c.60
 M  L  S  A  Q  E  R  A  Q  I  A  Q  V  W  D  L  I  A  G  H         p.20

          .         .         .   | 02     .         .         .    g.5322
 GAGGCGCAATTCGGGGCGGAGCTGCTGCTCAG | GCTCTTCACGGTGTACCCCAGCACCAAG    c.120
 E  A  Q  F  G  A  E  L  L  L  R  |  L  F  T  V  Y  P  S  T  K      p.40

          .         .         .         .         .         .       g.5382
 GTCTACTTCCCGCACCTGAGCGCCTGCCAGGACGCGACGCAGCTGCTGAGCCACGGGCAG       c.180
 V  Y  F  P  H  L  S  A  C  Q  D  A  T  Q  L  L  S  H  G  Q         p.60

          .         .         .         .         .         .       g.5442
 CGCATGCTGGCGGCTGTGGGCGCGGCGGTGCAGCACGTGGACAACCTGCGCGCCGCGCTG       c.240
 R  M  L  A  A  V  G  A  A  V  Q  H  V  D  N  L  R  A  A  L         p.80

          .         .         .         .         .        | 03.    g.5609
 AGCCCGCTGGCGGACCTGCACGCGCTCGTGCTGCGCGTGGACCCAGCCAACTTTCCG | CTG    c.300
 S  P  L  A  D  L  H  A  L  V  L  R  V  D  P  A  N  F  P   | L      p.100

          .         .         .         .         .         .       g.5669
 CTAATCCAGTGTTTCCACGTCGTGCTGGCCTCCCACCTGCAGGACGAGTTCACCGTGCAA       c.360
 L  I  Q  C  F  H  V  V  L  A  S  H  L  Q  D  E  F  T  V  Q         p.120

          .         .         .         .         .         .       g.5729
 ATGCAAGCGGCGTGGGACAAGTTCCTGACTGGTGTGGCCGTGGTGCTGACCGAAAAATAC       c.420
 M  Q  A  A  W  D  K  F  L  T  G  V  A  V  V  L  T  E  K  Y         p.140

                                                                    g.5735
 CGCTGA                                                             c.426
 R  X                                                               p.141

          .         .         .         .         .         .       g.5795
 gccctgtgctgcgcaggccttggtctgtgcctgtcaataaacagaggcccgaaccatctg       c.*60

 

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Hemoglobin, mu protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.