hepatic and glial cell adhesion molecule (HEPACAM) - 286 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.18728
gtgagctcccagccacccaatcacccatcccatcaacaatcagatcagtgggctgctggg  c.877+60

         .         .         .         .         .         .  g.18788
aaaaggcagaactgggcgacaaggaaaacagctctgcagggacccttcccccaccaactg  c.877+120

         .         .     g.18811
cacgaagactgcagaggagggaa  c.877+143

--------------------- middle of intron ---------------------
                          g.18812       .         .           g.18834
                          c.878-143  aggtttggccaaggtaggagcca  c.878-121

.         .         .         .         .         .           g.18894
ggatattcagatatgttggtggaggttgtggcgggccattcgggaagcacagagagtagg  c.878-61

.         .         .         .         .         .           g.18954
tgccggctggtggggagagtctgtacctgggccagccacccgcttctctcccctgtgcag  c.878-1


Powered by LOVD v.3.0 Build 29
©2004-2023 Leiden University Medical Center