hairy and enhancer of split 7 (Drosophila) (HES7) - coding DNA reference sequence

(used for variant description)

(last modified May 29, 2015)

This file was created to facilitate the description of sequence variants on transcript NM_032580.3 in the HES7 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_015816.1, covering HES7 transcript NM_032580.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5008
                                                     gaggagca       c.-1

          .         .         .         .   | 02     .         .    g.5984
 ATGGTCACCCGGGATCGAGCTGAGAATAGGGACGGCCCCAAG | ATGCTCAAGCCGCTTGTG    c.60
 M  V  T  R  D  R  A  E  N  R  D  G  P  K   | M  L  K  P  L  V      p.20

          .         .         .         .         .         .       g.6044
 GAGAAGCGGCGCCGGGACCGCATCAACCGCAGCCTGGAAGAGCTGAGGCTGCTGCTGCTG       c.120
 E  K  R  R  R  D  R  I  N  R  S  L  E  E  L  R  L  L  L  L         p.40

          .         | 03         .         .         .         .    g.6704
 GAGCGGACCCGGGACCAG | AACCTCCGGAACCCGAAGCTGGAGAAAGCGGAGATATTGGAG    c.180
 E  R  T  R  D  Q   | N  L  R  N  P  K  L  E  K  A  E  I  L  E      p.60

          .         .         .         .       | 04 .         .    g.7084
 TTCGCCGTGGGCTACTTGAGGGAGCGAAGCCGGGTGGAGCCCCCGG | GGGTTCCCCGGTCC    c.240
 F  A  V  G  Y  L  R  E  R  S  R  V  E  P  P  G |   V  P  R  S      p.80

          .         .         .         .         .         .       g.7144
 CCAGTCCAGGACGCCGAGGCGCTCGCCAGCTGCTACTTGTCCGGTTTCCGCGAGTGCCTG       c.300
 P  V  Q  D  A  E  A  L  A  S  C  Y  L  S  G  F  R  E  C  L         p.100

          .         .         .         .         .         .       g.7204
 CTTCGCTTGGCGGCCTTCGCGCACGACGCCAGCCCGGCCGCCCGCGCCCAGCTCTTCTCC       c.360
 L  R  L  A  A  F  A  H  D  A  S  P  A  A  R  A  Q  L  F  S         p.120

          .         .         .         .         .         .       g.7264
 GCGCTGCACGGCTATCTGCGCCCCAAACCGCCCCGGCCCAAGCCGGTAGATCCGAGGCCT       c.420
 A  L  H  G  Y  L  R  P  K  P  P  R  P  K  P  V  D  P  R  P         p.140

          .         .         .         .         .         .       g.7324
 CCAGCGCCGCGCCCATCCCTGGACCCCGCCGCACCGGCCCTTGGCCCTGCGCTGCACCAG       c.480
 P  A  P  R  P  S  L  D  P  A  A  P  A  L  G  P  A  L  H  Q         p.160

          .         .         .         .         .         .       g.7384
 CGCCCCCCAGTGCACCAGGGCCACCCTAGCCCGCGCTGCGCATGGTCCCCATCCCTCTGC       c.540
 R  P  P  V  H  Q  G  H  P  S  P  R  C  A  W  S  P  S  L  C         p.180

          .         .         .         .         .         .       g.7444
 TCCCCGCGCGCCGGGGATTCTGGCGCGCCGGCGCCCCTCACCGGACTGCTGCCGCCGCCA       c.600
 S  P  R  A  G  D  S  G  A  P  A  P  L  T  G  L  L  P  P  P         p.200

          .         .         .         .         .         .       g.7504
 CCGCCGCCTCACAGACAAGACGGGGCGCCCAAGGCCCCGCTGCCCCCGCCGCCCGCTTTC       c.660
 P  P  P  H  R  Q  D  G  A  P  K  A  P  L  P  P  P  P  A  F         p.220

          .                                                         g.7522
 TGGAGACCTTGGCCCTGA                                                 c.678
 W  R  P  W  P  X                                                   p.225

          .         .         .         .         .         .       g.7582
 gccttggggggtggtgggggcggggtctaggggtggggtagagactccagcccgagggca       c.*60

          .         .         .         .         .         .       g.7642
 gcagagggacccgggcgtccgggcgagcaggtgttggggagggcagtggggcgcgcgggc       c.*120

          .         .         .         .         .         .       g.7702
 tcagcgcgcgggtgagatgtggtctatattagagtatctatataaatatatatttccctg       c.*180

          .         .         .         .         .         .       g.7762
 gttcctgtcccttttccctgccccaacttctcccttgcgtctaggattgtactctctctg       c.*240

          .         .         .         .         .         .       g.7822
 cccctcagcccagtcccagtcccttcccgagtccctagtgcatggaataaagtggttatt       c.*300

          .         .         .         .         .         .       g.7882
 aaatccccgtgtgtccccgagccaggggcctgcctttatctcgacgtccacgcccacttt       c.*360

          .         .         .         .         .         .       g.7942
 cccttcccttctgtctcccaccctcagtcctgctctccatggcccaagccccggggcaga       c.*420

          .         .         .         .         .         .       g.8002
 caggtaagtaaagaagagagcagagcgggaactgagatcgaaattgaaaccaggtggaaa       c.*480

          .         .         .         .         .         .       g.8062
 gagagagatagggtagggggagaagggatgggggcctttaagaaaaaaacggataaaaag       c.*540

          .         .         .         .         .         .       g.8122
 gaaaaattgaaataaaatcgactctggtgggattcgaacccacaacctttgaattgctct       c.*600

          .         .         .         .         .         .       g.8182
 attcgtcactagaagtccaatgcgctatccattgcgccacagagccacccgacgaacggc       c.*660

          .         .         .         .         .         .       g.8242
 ggcgtcttgtagcttacgggtactagagtgggaatggggcagggttggggagcggggcta       c.*720

          .         .         .         .         .         .       g.8302
 agggacttgggcgggacatgccaggagggcgcggtttggatctcagaggccaagccaggt       c.*780

          .         .         .         .         .         .       g.8362
 agaggtagcgggcgcaaagcatgttagccaggtgagagagagggcgcacatgggtcgaaa       c.*840

          .         .         .         .         .         .       g.8422
 aaacagggagggagagcaaccgaaaatggctgagcgagcgagtgcagagctccggctgcc       c.*900

          .         .         .         .         .         .       g.8482
 cgcttggggggtgtttccggctcaggcgctccccactcccagatatagtcccacccaaat       c.*960

          .         .                                               g.8503
 aaactagttttgttgtaaatt                                              c.*981

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Hairy and enhancer of split 7 (Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.