histidine triad nucleotide binding protein 1 (HINT1) - coding DNA reference sequence

(used for variant description)

(last modified February 4, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_005340.6 in the HINT1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032998.1, covering HINT1 transcript NM_005340.6.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5023
                                      agtgcgcacgcgcaagattaggt       c.-121

 .         .         .         .         .         .                g.5083
 ggggcgccagagccggggcacctgcgcaggcttggctgcgccctctcgcgccgcacgctc       c.-61

 .         .         .         .         .         .                g.5143
 tgcgggttcctcccttcttccgagcctctcctctggccgccgcgcgggagagaggccgag       c.-1

          .         .         .         .         .         .       g.5203
 ATGGCAGATGAGATTGCCAAGGCTCAGGTCGCTCGGCCTGGTGGCGACACGATCTTTGGG       c.60
 M  A  D  E  I  A  K  A  Q  V  A  R  P  G  G  D  T  I  F  G         p.20

          .         .         .         .         .  | 02      .    g.7681
 AAGATCATCCGCAAGGAAATACCAGCCAAAATCATTTTTGAGGATGACCGG | TGCCTTGCT    c.120
 K  I  I  R  K  E  I  P  A  K  I  I  F  E  D  D  R   | C  L  A      p.40

          .         .         .         .         .         .       g.7741
 TTCCATGACATTTCCCCTCAAGCACCAACACATTTTCTGGTGATACCCAAGAAACATATA       c.180
 F  H  D  I  S  P  Q  A  P  T  H  F  L  V  I  P  K  K  H  I         p.60

          .         .         .       | 03 .         .         .    g.10761
 TCCCAGATTTCTGTGGCAGAAGATGATGATGAAAGT | CTTCTTGGACACTTAATGATTGTT    c.240
 S  Q  I  S  V  A  E  D  D  D  E  S   | L  L  G  H  L  M  I  V      p.80

          .         .         .         .         .         .       g.10821
 GGCAAGAAATGTGCTGCTGATCTGGGCCTGAATAAGGGTTATCGAATGGTGGTGAATGAA       c.300
 G  K  K  C  A  A  D  L  G  L  N  K  G  Y  R  M  V  V  N  E         p.100

          .         .         .         .         .         .       g.10881
 GGTTCAGATGGTGGACAGTCTGTCTATCACGTTCATCTCCATGTTCTTGGAGGTCGGCAA       c.360
 G  S  D  G  G  Q  S  V  Y  H  V  H  L  H  V  L  G  G  R  Q         p.120

          .         .                                               g.10902
 ATGCATTGGCCTCCTGGTTAA                                              c.381
 M  H  W  P  P  G  X                                                p.126

          .         .         .         .         .         .       g.10962
 gcacgttttggggataattttctcttctttaggcaatgattaagttaggcaatttccagt       c.*60

          .         .         .         .         .         .       g.11022
 atgttaagtaacacacttatttttgcctgtgtatggagagattcaagaaataattttaaa       c.*120

          .         .         .         .                           g.11066
 accgcatacataataaaagacattgttgcatggcttatagtctc                       c.*164

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Histidine triad nucleotide binding protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.