histone cluster 1, H4j (HIST1H4J) - coding DNA reference sequence

(used for variant description)

(last modified October 15, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_021968.3 in the HIST1H4J gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering HIST1H4J transcript NM_021968.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
          .         .         .         .         .         .       g.60
 ATGTCTGGCCGCGGCAAAGGCGGGAAGGGTCTTGGCAAAGGCGGCGCTAAGCGCCACCGT       c.60
 M  S  G  R  G  K  G  G  K  G  L  G  K  G  G  A  K  R  H  R         p.20

          .         .         .         .         .         .       g.120
 AAAGTACTGCGCGACAATATCCAGGGCATCACCAAGCCGGCCATCCGGCGCCTTGCTCGC       c.120
 K  V  L  R  D  N  I  Q  G  I  T  K  P  A  I  R  R  L  A  R         p.40

          .         .         .         .         .         .       g.180
 CGCGGCGGCGTGAAGCGCATCTCCGGCCTCATCTACGAGGAGACTCGCGGGGTGCTGAAG       c.180
 R  G  G  V  K  R  I  S  G  L  I  Y  E  E  T  R  G  V  L  K         p.60

          .         .         .         .         .         .       g.240
 GTGTTCCTGGAGAACGTGATCCGGGACGCCGTGACCTATACAGAGCACGCCAAGCGCAAG       c.240
 V  F  L  E  N  V  I  R  D  A  V  T  Y  T  E  H  A  K  R  K         p.80

          .         .         .         .         .         .       g.300
 ACGGTCACCGCCATGGATGTGGTCTACGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGT       c.300
 T  V  T  A  M  D  V  V  Y  A  L  K  R  Q  G  R  T  L  Y  G         p.100

          .                                                         g.312
 TTCGGTGGTTGA                                                       c.312
 F  G  G  X                                                         p.103

          .         .         .         .                           g.356
 gcgtccctttctatcaataaaaggcccttttcagggccacccta                       c.*44

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Histone cluster 1, H4j protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center