HNF1 homeobox A (HNF1A) - coding DNA reference sequence

(used for variant description)

(last modified June 21, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_000545.5 in the HNF1A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011731.2, covering HNF1A transcript NM_000545.5.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5023
                                      cgtggccctgtggcagccgagcc       c.-1

          .         .         .         .         .         .       g.5083
 ATGGTTTCTAAACTGAGCCAGCTGCAGACGGAGCTCCTGGCGGCCCTGCTCGAGTCAGGG       c.60
 M  V  S  K  L  S  Q  L  Q  T  E  L  L  A  A  L  L  E  S  G         p.20

          .         .         .         .         .         .       g.5143
 CTGAGCAAAGAGGCACTGATCCAGGCACTGGGTGAGCCGGGGCCCTACCTCCTGGCTGGA       c.120
 L  S  K  E  A  L  I  Q  A  L  G  E  P  G  P  Y  L  L  A  G         p.40

          .         .         .         .         .         .       g.5203
 GAAGGCCCCCTGGACAAGGGGGAGTCCTGCGGCGGCGGTCGAGGGGAGCTGGCTGAGCTG       c.180
 E  G  P  L  D  K  G  E  S  C  G  G  G  R  G  E  L  A  E  L         p.60

          .         .         .         .         .         .       g.5263
 CCCAATGGGCTGGGGGAGACTCGGGGCTCCGAGGACGAGACGGACGACGATGGGGAAGAC       c.240
 P  N  G  L  G  E  T  R  G  S  E  D  E  T  D  D  D  G  E  D         p.80

          .         .         .         .         .         .       g.5323
 TTCACGCCACCCATCCTCAAAGAGCTGGAGAACCTCAGCCCTGAGGAGGCGGCCCACCAG       c.300
 F  T  P  P  I  L  K  E  L  E  N  L  S  P  E  E  A  A  H  Q         p.100

          .         .       | 02 .         .         .         .    g.15121
 AAAGCCGTGGTGGAGACCCTTCTGCA | GGAGGACCCGTGGCGTGTGGCGAAGATGGTCAAG    c.360
 K  A  V  V  E  T  L  L  Q  |  E  D  P  W  R  V  A  K  M  V  K      p.120

          .         .         .         .         .         .       g.15181
 TCCTACCTGCAGCAGCACAACATCCCACAGCGGGAGGTGGTCGATACCACTGGCCTCAAC       c.420
 S  Y  L  Q  Q  H  N  I  P  Q  R  E  V  V  D  T  T  G  L  N         p.140

          .         .         .         .         .         .       g.15241
 CAGTCCCACCTGTCCCAACACCTCAACAAGGGCACTCCCATGAAGACGCAGAAGCGGGCC       c.480
 Q  S  H  L  S  Q  H  L  N  K  G  T  P  M  K  T  Q  K  R  A         p.160

          .         .         .         .       | 03 .         .    g.19788
 GCCCTGTACACCTGGTACGTCCGCAAGCAGCGAGAGGTGGCGCAGC | AGTTCACCCATGCA    c.540
 A  L  Y  T  W  Y  V  R  K  Q  R  E  V  A  Q  Q |   F  T  H  A      p.180

          .         .         .         .         .         .       g.19848
 GGGCAGGGAGGGCTGATTGAAGAGCCCACAGGTGATGAGCTACCAACCAAGAAGGGGCGG       c.600
 G  Q  G  G  L  I  E  E  P  T  G  D  E  L  P  T  K  K  G  R         p.200

          .         .         .         .         .         .       g.19908
 AGGAACCGTTTCAAGTGGGGCCCAGCATCCCAGCAGATCCTGTTCCAGGCCTATGAGAGG       c.660
 R  N  R  F  K  W  G  P  A  S  Q  Q  I  L  F  Q  A  Y  E  R         p.220

          .         .         .         .         .    | 04    .    g.20425
 CAGAAGAACCCTAGCAAGGAGGAGCGAGAGACGCTAGTGGAGGAGTGCAATAG | GGCGGAA    c.720
 Q  K  N  P  S  K  E  E  R  E  T  L  V  E  E  C  N  R  |  A  E      p.240

          .         .         .         .         .         .       g.20485
 TGCATCCAGAGAGGGGTGTCCCCATCACAGGCACAGGGGCTGGGCTCCAACCTCGTCACG       c.780
 C  I  Q  R  G  V  S  P  S  Q  A  Q  G  L  G  S  N  L  V  T         p.260

          .         .         .         .         .         .       g.20545
 GAGGTGCGTGTCTACAACTGGTTTGCCAACCGGCGCAAAGAAGAAGCCTTCCGGCACAAG       c.840
 E  V  R  V  Y  N  W  F  A  N  R  R  K  E  E  A  F  R  H  K         p.280

          .         .         .         .         .         .       g.20605
 CTGGCCATGGACACGTACAGCGGGCCCCCCCCAGGGCCAGGCCCGGGACCTGCGCTGCCC       c.900
 L  A  M  D  T  Y  S  G  P  P  P  G  P  G  P  G  P  A  L  P         p.300

          .         .         .         .         .      | 05  .    g.22521
 GCTCACAGCTCCCCTGGCCTGCCTCCACCTGCCCTCTCCCCCAGTAAGGTCCACG | GTGTG    c.960
 A  H  S  S  P  G  L  P  P  P  A  L  S  P  S  K  V  H  G |   V      p.320

          .         .         .         .         .         .       g.22581
 CGCTATGGACAGCCTGCGACCAGTGAGACTGCAGAAGTACCCTCAAGCAGCGGCGGTCCC       c.1020
 R  Y  G  Q  P  A  T  S  E  T  A  E  V  P  S  S  S  G  G  P         p.340

          .         .         .         .         .         .       g.22641
 TTAGTGACAGTGTCTACACCCCTCCACCAAGTGTCCCCCACGGGCCTGGAGCCCAGCCAC       c.1080
 L  V  T  V  S  T  P  L  H  Q  V  S  P  T  G  L  E  P  S  H         p.360

          .         .        | 06.         .         .         .    g.22828
 AGCCTGCTGAGTACAGAAGCCAAGCTG | GTCTCAGCAGCTGGGGGCCCCCTCCCCCCTGTC    c.1140
 S  L  L  S  T  E  A  K  L   | V  S  A  A  G  G  P  L  P  P  V      p.380

          .         .         .         .         .         .       g.22888
 AGCACCCTGACAGCACTGCACAGCTTGGAGCAGACATCCCCAGGCCTCAACCAGCAGCCC       c.1200
 S  T  L  T  A  L  H  S  L  E  Q  T  S  P  G  L  N  Q  Q  P         p.400

          .         .         .         .         .         .       g.22948
 CAGAACCTCATCATGGCCTCACTTCCTGGGGTCATGACCATCGGGCCTGGTGAGCCTGCC       c.1260
 Q  N  L  I  M  A  S  L  P  G  V  M  T  I  G  P  G  E  P  A         p.420

          .         .         .         .          | 07        .    g.23739
 TCCCTGGGTCCTACGTTCACCAACACAGGTGCCTCCACCCTGGTCATCG | GCCTGGCCTCC    c.1320
 S  L  G  P  T  F  T  N  T  G  A  S  T  L  V  I  G |   L  A  S      p.440

          .         .         .         .         .         .       g.23799
 ACGCAGGCACAGAGTGTGCCGGTCATCAACAGCATGGGCAGCAGCCTGACCACCCTGCAG       c.1380
 T  Q  A  Q  S  V  P  V  I  N  S  M  G  S  S  L  T  T  L  Q         p.460

          .         .         .         .         .         .       g.23859
 CCCGTCCAGTTCTCCCAGCCGCTGCACCCCTCCTACCAGCAGCCGCTCATGCCACCTGTG       c.1440
 P  V  Q  F  S  Q  P  L  H  P  S  Y  Q  Q  P  L  M  P  P  V         p.480

          .         .         .         .         .         .       g.23919
 CAGAGCCATGTGACCCAGAGCCCCTTCATGGCCACCATGGCTCAGCTGCAGAGCCCCCAC       c.1500
 Q  S  H  V  T  Q  S  P  F  M  A  T  M  A  Q  L  Q  S  P  H         p.500

   | 08      .         .         .         .         .         .    g.25581
 G | CCCTCTACAGCCACAAGCCCGAGGTGGCCCAGTACACCCACACGGGCCTGCTCCCGCAG    c.1560
 A |   L  Y  S  H  K  P  E  V  A  Q  Y  T  H  T  G  L  L  P  Q      p.520

          .         .         .         .         .         .       g.25641
 ACTATGCTCATCACCGACACCACCAACCTGAGCGCCCTGGCCAGCCTCACGCCCACCAAG       c.1620
 T  M  L  I  T  D  T  T  N  L  S  A  L  A  S  L  T  P  T  K         p.540

     | 09    .         .         .         .         .         .    g.25794
 CAG | GTCTTCACCTCAGACACTGAGGCCTCCAGTGAGTCCGGGCTTCACACGCCGGCATCT    c.1680
 Q   | V  F  T  S  D  T  E  A  S  S  E  S  G  L  H  T  P  A  S      p.560

          .         .         .         .         .         .       g.25854
 CAGGCCACCACCCTCCACGTCCCCAGCCAGGACCCTGCCGGCATCCAGCACCTGCAGCCG       c.1740
 Q  A  T  T  L  H  V  P  S  Q  D  P  A  G  I  Q  H  L  Q  P         p.580

          .         .         | 10         .         .         .    g.27351
 GCCCACCGGCTCAGCGCCAGCCCCACAG | TGTCCTCCAGCAGCCTGGTGCTGTACCAGAGC    c.1800
 A  H  R  L  S  A  S  P  T  V |   S  S  S  S  L  V  L  Y  Q  S      p.600

          .         .         .         .         .         .       g.27411
 TCAGACTCCAGCAATGGCCAGAGCCACCTGCTGCCATCCAACCACAGCGTCATCGAGACC       c.1860
 S  D  S  S  N  G  Q  S  H  L  L  P  S  N  H  S  V  I  E  T         p.620

          .         .         .                                     g.27447
 TTCATCTCCACCCAGATGGCCTCTTCCTCCCAGTAA                               c.1896
 F  I  S  T  Q  M  A  S  S  S  Q  X                                 p.631

          .         .         .         .         .         .       g.27507
 ccacggcacctgggccctggggcctgtactgcctgcttggggggtgatgagggcagcagc       c.*60

          .         .         .         .         .         .       g.27567
 cagccctgcctggaggacctgagcctgccgagcaaccgtggcccttcctggacagctgtg       c.*120

          .         .         .         .         .         .       g.27627
 cctcgctccccactctgctctgatgcatcagaaagggagggctctgaggcgccccaaccc       c.*180

          .         .         .         .         .         .       g.27687
 gtggaggctgctcggggtgcacaggagggggtcgtggagagctaggagcaaagcctgttc       c.*240

          .         .         .         .         .         .       g.27747
 atggcagatgtaggagggactgtcgctgcttcgtgggatacagtcttcttacttggaact       c.*300

          .         .         .         .         .         .       g.27807
 gaagggggcggcctatgacttgggcacccccagcctgggcctatggagagccctgggacc       c.*360

          .         .         .         .         .         .       g.27867
 gctacaccactctggcagccacacttctcaggacacaggcctgtgtagctgtgacctgct       c.*420

          .         .         .         .         .         .       g.27927
 gagctctgagaggccctggatcagcgtggccttgttctgtcaccaatgtacccaccgggc       c.*480

          .         .         .         .         .         .       g.27987
 cactccttcctgccccaactccttccagctagtgacccacatgccatttgtactgacccc       c.*540

          .         .         .         .         .         .       g.28047
 atcacctactcacacaggcatttcctgggtggctactctgtgccagagcctggggctcta       c.*600

          .         .         .         .         .         .       g.28107
 acgcctgagcccagggaggccgaagctaacagggaaggcaggcagggctctcctggcttc       c.*660

          .         .         .         .         .         .       g.28167
 ccatccccagcgattccctctcccaggccccatgacctccagctttcctgtatttgttcc       c.*720

          .         .         .         .         .         .       g.28227
 caagagcatcatgcctctgaggccagcctggcctcctgcctctactgggaaggctacttc       c.*780

          .         .         .         .         .         .       g.28287
 ggggctgggaagtcgtccttactcctgtgggagcctcgcaacccgtgccaagtccaggtc       c.*840

          .         .         .         .         .         .       g.28347
 ctggtggggcagctcctctgtctcgagcgccctgcagaccctgcccttgtttggggcagg       c.*900

          .         .         .         .         .         .       g.28407
 agtagctgagctcacaaggcagcaaggcccgagcagctgagcagggccggggaactggcc       c.*960

          .         .         .         .         .         .       g.28467
 aagctgaggtgcccaggagaagaaagaggtgaccccagggcacaggagctacctgtgtgg       c.*1020

          .         .         .         .         .         .       g.28527
 acaggactaacactcagaagcctgggggcctggctggctgagggcagttcgcagccaccc       c.*1080

          .         .         .         .         .         .       g.28587
 tgaggagtctgaggtcctgagcactgccaggagggacaaaggagcctgtgaacccaggac       c.*1140

          .         .         .         .         .         .       g.28647
 aagcatggtcccacatccctgggcctgctgctgagaacctggccttcagtgtaccgcgtc       c.*1200

          .         .         .         .         .         .       g.28707
 taccctgggattcaggaaaaggcctggggtgacccggcaccccctgcagcttgtagccag       c.*1260

          .         .         .         .         .         .       g.28767
 ccggggcgagtggcacgtttatttaacttttagtaaagtcaaggagaaatgcggtggaaa       c.*1320

 

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The HNF1 homeobox A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center