homeobox C13 (HOXC13) - coding DNA reference sequence

(used for variant description)

(last modified December 6, 2012)

This file was created to facilitate the description of sequence variants on transcript NM_017410.2 in the HOXC13 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering HOXC13 transcript NM_017410.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5055
      aggggtggagagaaaagaggggagggatggggggaggggaaacaggagcgaggtg       c.-61

 .         .         .         .         .         .                g.5115
 tctccctagctcgctgcctctggcaagtggagtttttaaaaagctccagcagatcatgtc       c.-1

          .         .         .         .         .         .       g.5175
 ATGACGACTTCGCTGCTCCTGCATCCACGCTGGCCGGAGAGCCTTATGTACGTCTATGAG       c.60
 M  T  T  S  L  L  L  H  P  R  W  P  E  S  L  M  Y  V  Y  E         p.20

          .         .         .         .         .         .       g.5235
 GACAGCGCGGCGGAGAGCGGCATCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGCACGGGC       c.120
 D  S  A  A  E  S  G  I  G  G  G  G  G  G  G  G  G  G  T  G         p.40

          .         .         .         .         .         .       g.5295
 GGAGCGGGGGGTGGCTGCAGCGGAGCGAGCCCCGGCAAAGCCCCGAGCATGGATGGTCTG       c.180
 G  A  G  G  G  C  S  G  A  S  P  G  K  A  P  S  M  D  G  L         p.60

          .         .         .         .         .         .       g.5355
 GGCAGCAGCTGCCCGGCCAGCCACTGCCGCGACCTGCTTCCGCACCCCGTGCTGGGCCGC       c.240
 G  S  S  C  P  A  S  H  C  R  D  L  L  P  H  P  V  L  G  R         p.80

          .         .         .         .         .         .       g.5415
 CCGCCGGCTCCCCTGGGCGCCCCTCAGGGCGCCGTCTATACGGACATCCCGGCCCCGGAG       c.300
 P  P  A  P  L  G  A  P  Q  G  A  V  Y  T  D  I  P  A  P  E         p.100

          .         .         .         .         .         .       g.5475
 GCGGCGCGCCAGTGTGCCCCGCCGCCCGCACCCCCCACCTCGTCCAGCGCCACCCTGGGC       c.360
 A  A  R  Q  C  A  P  P  P  A  P  P  T  S  S  S  A  T  L  G         p.120

          .         .         .         .         .         .       g.5535
 TACGGCTACCCCTTCGGGGGCAGCTACTACGGCTGCCGCCTGTCGCACAACGTGAACCTG       c.420
 Y  G  Y  P  F  G  G  S  Y  Y  G  C  R  L  S  H  N  V  N  L         p.140

          .         .         .         .         .         .       g.5595
 CAGCAGAAGCCTTGCGCCTACCACCCGGGCGATAAATACCCGGAGCCGTCGGGCGCCCTG       c.480
 Q  Q  K  P  C  A  Y  H  P  G  D  K  Y  P  E  P  S  G  A  L         p.160

          .         .         .         .         .         .       g.5655
 CCCGGTGACGACCTGTCCTCTAGGGCCAAGGAGTTCGCCTTCTACCCCAGCTTCGCCAGC       c.540
 P  G  D  D  L  S  S  R  A  K  E  F  A  F  Y  P  S  F  A  S         p.180

          .         .         .         .         .         .       g.5715
 TCCTACCAGGCGATGCCCGGCTACCTGGACGTGTCGGTGGTGCCCGGGATCAGCGGGCAC       c.600
 S  Y  Q  A  M  P  G  Y  L  D  V  S  V  V  P  G  I  S  G  H         p.200

          .         .         .         .         .         .       g.5775
 CCGGAGCCGCGTCACGACGCCCTCATCCCCGTCGAAGGCTACCAGCACTGGGCTCTCTCC       c.660
 P  E  P  R  H  D  A  L  I  P  V  E  G  Y  Q  H  W  A  L  S         p.220

          .         .         .         .         .         .       g.5835
 AATGGCTGGGACAGTCAGGTGTACTGCTCCAAGGAGCAGTCGCAGTCCGCCCACCTCTGG       c.720
 N  G  W  D  S  Q  V  Y  C  S  K  E  Q  S  Q  S  A  H  L  W         p.240

          .       | 02 .         .         .         .         .    g.11252
 AAGTCTCCCTTCCCAG | ACGTGGTTCCCCTGCAGCCCGAGGTGAGCAGCTACCGGCGCGGG    c.780
 K  S  P  F  P  D |   V  V  P  L  Q  P  E  V  S  S  Y  R  R  G      p.260

          .         .         .         .         .         .       g.11312
 CGCAAGAAACGCGTGCCCTACACTAAGGTGCAGCTGAAGGAGCTAGAGAAGGAATACGCG       c.840
 R  K  K  R  V  P  Y  T  K  V  Q  L  K  E  L  E  K  E  Y  A         p.280

          .         .         .         .         .         .       g.11372
 GCTAGCAAGTTCATCACCAAAGAGAAGCGCCGGCGCATCTCCGCCACCACGAACCTCTCT       c.900
 A  S  K  F  I  T  K  E  K  R  R  R  I  S  A  T  T  N  L  S         p.300

          .         .         .         .         .         .       g.11432
 GAGCGCCAGGTAACCATCTGGTTCCAGAACCGGCGGGTCAAAGAGAAGAAGGTGGTCAGC       c.960
 E  R  Q  V  T  I  W  F  Q  N  R  R  V  K  E  K  K  V  V  S         p.320

          .         .         .                                     g.11465
 AAATCGAAAGCGCCTCATCTCCACTCCACCTGA                                  c.993
 K  S  K  A  P  H  L  H  S  T  X                                    p.330

          .         .         .         .         .         .       g.11525
 ccacccacccgctgcttgccccatctatttatgtctccgctttgtaccataaccgaaccc       c.*60

          .         .         .         .         .         .       g.11585
 acggaaagacgctgcgcgggtgcagaagagtatttaatgttaaggaaagagaagaaccgc       c.*120

          .         .         .         .         .         .       g.11645
 gccgcccggaggcagagaggctccatggccgtgctgctgggccatccccaactccctatc       c.*180

          .         .         .         .         .         .       g.11705
 ccatccccagcctccacccccatccagatgggactcacgtggcttcaacagctttggaaa       c.*240

          .         .         .         .         .         .       g.11765
 tgggtcccgagtgggccgtgcgaggaaggctgtcgacctctactcctccttgcgctcacc       c.*300

          .         .         .         .         .         .       g.11825
 ttgccagaaagtctggtggcagcgcagagcccaatcattccaaccaaagcagggttgggg       c.*360

          .         .         .         .         .         .       g.11885
 aatcccgaatggccccaattcttgcctcatcctatgaccaggcttttagaggaccttccc       c.*420

          .         .         .         .         .         .       g.11945
 taagggcgcagcttcggagcaggatctgtccagctcatactttccttcgctgtccctccc       c.*480

          .         .         .         .         .         .       g.12005
 gcactccttaggcaagatttcccagtaaagattttctgtgcgtattttaaaagtcgtgtt       c.*540

          .         .         .         .         .         .       g.12065
 aatactcatgataattattagggacctggcagcgtgattggagtatggatgtttccgtaa       c.*600

          .         .         .         .         .         .       g.12125
 aagctggaattccgtaaaagcattgacgcagcccctacactccatcccaaccaagaaact       c.*660

          .         .         .         .         .         .       g.12185
 gcatttcctggggccaggtgggagctgcctttgccccactgcctcccctgttctgctctc       c.*720

          .         .         .         .         .         .       g.12245
 tcagtcaacatgtggaaatccaaggaggacaaagactccagccacgctgctaaatagggc       c.*780

          .         .         .         .         .         .       g.12305
 tcctctctcctctctctctctctaggtggtaaggttggggattagtccaggtacagaagc       c.*840

          .         .         .         .         .         .       g.12365
 agaacttttttctaaggataaacatctcttccaaggggatggagagtgggtccctcaaca       c.*900

          .         .         .         .         .         .       g.12425
 aagtccctgtccagtcacctttccatcagggcactagcccaggaatgactcctcacactt       c.*960

          .         .         .         .         .         .       g.12485
 tcacctttactgatttccagaggaaagctagaggatctagttcaagaggcaagaagatct       c.*1020

          .         .         .         .         .         .       g.12545
 ggccctcaattagctagatgtagatgctgcctaacagttccctcctcaaaggccaccttg       c.*1080

          .         .         .         .         .         .       g.12605
 gtgctgtgggggccccttgcctcttcccttcccactggtgcattacaaaacagtgttctt       c.*1140

          .         .         .         .         .         .       g.12665
 ttgaaatgttcatcaggaataggcttttttaaaaaatgttgtgtatctgtatatagtatt       c.*1200

          .         .         .         .         .         .       g.12725
 gtgatgtctgaatgacaatgtactgaatgcaaaaaggaaaaaaacccacaaacatgtttt       c.*1260

          .         .                                               g.12753
 taaaataaaatatctttttttgccttga                                       c.*1288

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Homeobox C13 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.