Hermansky-Pudlak syndrome 3 (HPS3) - coding DNA reference sequence

(used for variant description)

(last modified July 23, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_032383.3 in the HPS3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009847.1, covering HPS3 transcript NM_032383.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5020
                                         ccgcgggcggggccggctgg       c.-121

 .         .         .         .         .         .                g.5080
 cgttcacgtgacccggcgtcattggctcgctcgcggaagtagtcctacattcgcggtcag       c.-61

 .         .         .         .         .         .                g.5140
 cgcggggtctccgggcgccctgcagggcgggcaggctgtgccatcccgccggacgtcggg       c.-1

          .         .         .         .         .         .       g.5200
 ATGGTGCAGCTGTACAACCTGCACCCGTTCGGGTCGCAGCAGGTGGTGCCCTGCAAGCTG       c.60
 M  V  Q  L  Y  N  L  H  P  F  G  S  Q  Q  V  V  P  C  K  L         p.20

          .         .         .         .         .         .       g.5260
 GAGCCGGACCGGTTCTGTGGCGGGGGGCGTGACGCGCTTTTCGTGGCGGCGGGCTGCAAG       c.120
 E  P  D  R  F  C  G  G  G  R  D  A  L  F  V  A  A  G  C  K         p.40

          .         .         .         .         .         .       g.5320
 GTGGAGGCGTTCGCGGTGGCCGGCCAGGAGCTGTGCCAGCCGCGGTGCGCCTTCTCCACG       c.180
 V  E  A  F  A  V  A  G  Q  E  L  C  Q  P  R  C  A  F  S  T         p.60

          .         .         .        | 02.         .         .    g.15443
 CTGGGCCGGGTGTTGCGCCTGGCCTACAGCGAGGCTG | GAGATTATTTGGTAGCAATTGAA    c.240
 L  G  R  V  L  R  L  A  Y  S  E  A  G |   D  Y  L  V  A  I  E      p.80

          .         .         .         .         .         .       g.15503
 GAGAAAAACAAAGCTACATTTCTACGTGCTTATGTGAACTGGAGAAATAAAAGGACTGAA       c.300
 E  K  N  K  A  T  F  L  R  A  Y  V  N  W  R  N  K  R  T  E         p.100

          .         .         .         .         .         .       g.15563
 AACTCTCGTGTGTGTATCCGAATGATTGGGCATAATGTGGAGGGACCATTCAGCAAAGCC       c.360
 N  S  R  V  C  I  R  M  I  G  H  N  V  E  G  P  F  S  K  A         p.120

          .         .         .         .         .         .       g.15623
 TTCAGAGACCAGATGTACATTATTGAAATGCCGCTTTCGGAGGCCCCCTTGTGCATTTCC       c.420
 F  R  D  Q  M  Y  I  I  E  M  P  L  S  E  A  P  L  C  I  S         p.140

          .         .         .         .         .         .       g.15683
 TGTTGCCCTGTGAAAGGAGACCTTCTCGTTGGCTGCACAAATAAATTAGTCTTATTTAGT       c.480
 C  C  P  V  K  G  D  L  L  V  G  C  T  N  K  L  V  L  F  S         p.160

          .         .         .         .         .         .       g.15743
 TTGAAGTACCAGATCATTAATGAGGAATTCTCACTATTGGACTTTGAACGTTCTTTAATT       c.540
 L  K  Y  Q  I  I  N  E  E  F  S  L  L  D  F  E  R  S  L  I         p.180

          .         .         .         .         .         .       g.15803
 ATACACATAGATAATATCACTCCTGTTGAGGTTTCTTTTTGTGTTGGATATGTTGCTGTC       c.600
 I  H  I  D  N  I  T  P  V  E  V  S  F  C  V  G  Y  V  A  V         p.200

          .         .         .         .         .         .       g.15863
 ATGTCAGACTTAGAAGTCTTAATCGTAAAACTGGAGTCAGGCCCTAAAAATGGAGAGAGA       c.660
 M  S  D  L  E  V  L  I  V  K  L  E  S  G  P  K  N  G  E  R         p.220

          .         .         .         .         .   | 03     .    g.16441
 GTTCACCACCATCCACATAAGACCAACAATCGAATAAGACGGACAGAAGAAG | GCATCAGT    c.720
 V  H  H  H  P  H  K  T  N  N  R  I  R  R  T  E  E  G |   I  S      p.240

          .         .         .         .         .         .       g.16501
 AATGAAATTTCACAGCTTGAGTCAGATGATTTTGTCATCTGCCAGAAGCCCCTGGAACTT       c.780
 N  E  I  S  Q  L  E  S  D  D  F  V  I  C  Q  K  P  L  E  L         p.260

          .         .         .         .         .         .       g.16561
 CTTGGTGAAAAAAGTGAACAGTCTGGATTATCTGTTACACTGGAGTCTACGGGATTAGCT       c.840
 L  G  E  K  S  E  Q  S  G  L  S  V  T  L  E  S  T  G  L  A         p.280

          .         .         .         .     | 04   .         .    g.16727
 GATGAAAAAAGAAAATATTCCCACTTTCAGCACCTGCTCTATAG | ACGTTTTGCTCCTGAT    c.900
 D  E  K  R  K  Y  S  H  F  Q  H  L  L  Y  R  |  R  F  A  P  D      p.300

          .         .         .         .         .         .       g.16787
 ATTTCGTCCTATGTCTTGTCTGATGACATCAAGCTACATTCCCTCCAGCTGCTACCCATT       c.960
 I  S  S  Y  V  L  S  D  D  I  K  L  H  S  L  Q  L  L  P  I         p.320

          . | 05       .         .         .         .         .    g.20820
 TACCAGACCG | GTTCTCTTACATCTGATGGAAAAAATTTGTCTCAGGAAAAAGAATTGCTG    c.1020
 Y  Q  T  G |   S  L  T  S  D  G  K  N  L  S  Q  E  K  E  L  L      p.340

          .         .         .         .         .         .       g.20880
 AGTCTCTTTTGCTTTTTCTCCTTACCTCATGTGGGCTATCTCTACATGGTTGTCAAATCT       c.1080
 S  L  F  C  F  F  S  L  P  H  V  G  Y  L  Y  M  V  V  K  S         p.360

          .         .         .         .         .         .       g.20940
 GTTGAATTGATGTCAGTCTACCAGTATCCTGAAAAGTCTCAGCAGGCAGTACTCACGCCA       c.1140
 V  E  L  M  S  V  Y  Q  Y  P  E  K  S  Q  Q  A  V  L  T  P         p.380

          .         .    | 06    .         .         .         .    g.26052
 CAATTTTTGCACGTCATTACAAG | TAACAACCTGCAGTGTTTCACTGTGCGGTGCAGTGCG    c.1200
 Q  F  L  H  V  I  T  S  |  N  N  L  Q  C  F  T  V  R  C  S  A      p.400

          .         .         .         .      | 07  .         .    g.28925
 GCGGCAGCTCGTGAGGAGGACCCGTACATGGACACCACCCTGAAG | GCTTGCCCACCTGTC    c.1260
 A  A  A  R  E  E  D  P  Y  M  D  T  T  L  K   | A  C  P  P  V      p.420

          .         .         .         .         .         .       g.28985
 AGTATGGATGTCTGTGCTTTAAGAATACAGCTTTTCATAGGCTTGAAAGCCATCTGTCAC       c.1320
 S  M  D  V  C  A  L  R  I  Q  L  F  I  G  L  K  A  I  C  H         p.440

          .         .         .         .         .         .       g.29045
 TTTAAAAACCACATCATACTTTTGACTAAAGCAGAACCTGAAGCCATTCCAGAGAGAAGA       c.1380
 F  K  N  H  I  I  L  L  T  K  A  E  P  E  A  I  P  E  R  R         p.460

          .         . | 08       .         .         .         .    g.30563
 CAGTCACCCAAGAGGCTTCT | TTCGAGAAAAGATACCAGTGTTAAAATCAAAATACCTCCT    c.1440
 Q  S  P  K  R  L  L  |  S  R  K  D  T  S  V  K  I  K  I  P  P      p.480

          .         .         .         .         .         .       g.30623
 GTAGCTGAGGCTGGGTGGAATTTGTATATTGTGAATACGATCTCACCAGTGCAGCTGTAC       c.1500
 V  A  E  A  G  W  N  L  Y  I  V  N  T  I  S  P  V  Q  L  Y         p.500

           | 09        .         .         .         .         .    g.32817
 AAAGAGATG | GTAGACTATAGCAATACCTATAAGACTGTCAAAACCCAGAGCTGCATTCAC    c.1560
 K  E  M   | V  D  Y  S  N  T  Y  K  T  V  K  T  Q  S  C  I  H      p.520

          .         .         .         .         .         .       g.32877
 CTTCTCAGTGAGGCTCATCTGTTAGTGCGAGCTGCCCTGATGGATGCCAGTCAGCTGGAA       c.1620
 L  L  S  E  A  H  L  L  V  R  A  A  L  M  D  A  S  Q  L  E         p.540

          .         .         .         .         .         .       g.32937
 CCTGGAGAGAAGGCAGAGCTTTTGGAAGCATTTAAGGAAAGCTGTGGGCACCTTGGGGAC       c.1680
 P  G  E  K  A  E  L  L  E  A  F  K  E  S  C  G  H  L  G  D         p.560

          .  | 10      .         .         .         .         .    g.34131
 TGTTACAGCAG | GCTTGACTCCCAGCATTCTCATCTCACCTTGCCATACTATAAGATGTCT    c.1740
 C  Y  S  R  |  L  D  S  Q  H  S  H  L  T  L  P  Y  Y  K  M  S      p.580

          .         .         .         .         .         .       g.34191
 GGTTTGTCTATGGCTGAAGTTCTGGCCCGCACGGACTGGACAGTAGAGGATGGATTACAG       c.1800
 G  L  S  M  A  E  V  L  A  R  T  D  W  T  V  E  D  G  L  Q         p.600

          .         .         .         .         .         .       g.34251
 AAATACGAGAGAGGATTAATCTTTTACATTAATCATTCACTTTATGAAAACCTGGATGAA       c.1860
 K  Y  E  R  G  L  I  F  Y  I  N  H  S  L  Y  E  N  L  D  E         p.620

          .   | 11     .         .         .         .         .    g.35510
 GAATTAAATGAA | GAATTAGCAGCAAAAGTGGTTCAGATGTTTTATGTGGCTGAGCCAAAG    c.1920
 E  L  N  E   | E  L  A  A  K  V  V  Q  M  F  Y  V  A  E  P  K      p.640

          .         .         .         .         .         .       g.35570
 CAAGTGCCCCATATTCTCTGTAGTCCTTCTATGAAGAATATTAATCCTTTAACTGCCATG       c.1980
 Q  V  P  H  I  L  C  S  P  S  M  K  N  I  N  P  L  T  A  M         p.660

          .         .         .         .         .         .       g.35630
 AGCTATCTAAGGAAGCTGGATACTTCTGGGTTTTCATCGATCTTAGTGACATTGACCAAG       c.2040
 S  Y  L  R  K  L  D  T  S  G  F  S  S  I  L  V  T  L  T  K         p.680

          .         .         .         .         .         .       g.35690
 GCAGCAGTGGCTCTGAAAATGGGAGATCTTGACATGCACAGAAATGAAATGAAAAGCCAT       c.2100
 A  A  V  A  L  K  M  G  D  L  D  M  H  R  N  E  M  K  S  H         p.700

        | 12 .         .         .         .         .         .    g.37618
 TCAGAG | ATGAAGTTGGTATGTGGCTTCATTCTGGAACCTCGGCTGTTGATTCAACAGAGA    c.2160
 S  E   | M  K  L  V  C  G  F  I  L  E  P  R  L  L  I  Q  Q  R      p.720

          .         .         .         .         .         .       g.37678
 AAGGGACAGATTGTTCCAACCGAGCTTGCACTTCACTTGAAGGAAACTCAGCCTGGATTG       c.2220
 K  G  Q  I  V  P  T  E  L  A  L  H  L  K  E  T  Q  P  G  L         p.740

          .         .         .         .         .         .       g.37738
 CTTGTGGCTTCAGTTCTGGGCTTGCAGAAGAACAACAAAATTGGAATTGAAGAAGCAGAT       c.2280
 L  V  A  S  V  L  G  L  Q  K  N  N  K  I  G  I  E  E  A  D         p.760

          .   | 13     .         .         .         .         .    g.38154
 TCCTTTTTTAAG | GTGCTTTGTGCTAAGGATGAAGATACAATTCCTCAGCTCTTGGTAGAC    c.2340
 S  F  F  K   | V  L  C  A  K  D  E  D  T  I  P  Q  L  L  V  D      p.780

          .         .         .         .         .         .       g.38214
 TTTTGGGAAGCTCAGCTAGTGGCATGTCTCCCAGATGTGGTACTTCAGGAACTCTTTTTC       c.2400
 F  W  E  A  Q  L  V  A  C  L  P  D  V  V  L  Q  E  L  F  F         p.800

          .         .         .         .         .         .       g.38274
 AAACTCACATCACAGTACATCTGGAGATTGTCTAAGAGGCAGCCTCCTGACACCACACCA       c.2460
 K  L  T  S  Q  Y  I  W  R  L  S  K  R  Q  P  P  D  T  T  P         p.820

          .         .  | 14      .         .         .         .    g.39297
 TTGCGAACATCGGAGGATCTG | ATAAATGCCTGTAGTCATTATGGCTTAATTTATCCATGG    c.2520
 L  R  T  S  E  D  L   | I  N  A  C  S  H  Y  G  L  I  Y  P  W      p.840

          .         .         .         .         .         .       g.39357
 GTTCACGTCGTAATATCATCTGATTCTTTAGCTGATAAAAATTATACAGAAGATCTTTCA       c.2580
 V  H  V  V  I  S  S  D  S  L  A  D  K  N  Y  T  E  D  L  S         p.860

           | 15        .         .         .         .         .    g.42501
 AAATTACAG | TCTCTTATATGTGGTCCTTCATTTGACATAGCTTCCATTATTCCGTTCTTG    c.2640
 K  L  Q   | S  L  I  C  G  P  S  F  D  I  A  S  I  I  P  F  L      p.880

          .         .         .         .         .         .       g.42561
 GAGCCACTTTCAGAAGACACTATTGCCGGCCTCAGTGTCCATGTTCTGTGTCGTACACGC       c.2700
 E  P  L  S  E  D  T  I  A  G  L  S  V  H  V  L  C  R  T  R         p.900

          .         .         .         .         .         .       g.42621
 TTGAAAGAGTATGAACAGTGCATAGACATACTGTTAGAGAGATGCCCGGAGGCAGTCATT       c.2760
 L  K  E  Y  E  Q  C  I  D  I  L  L  E  R  C  P  E  A  V  I         p.920

          .         .         .       | 16 .         .         .    g.43333
 CCATATGCTAATCATGAACTGAAAGAAGAGAACCGG | ACTCTGTGGTGGAAAAAACTGTTG    c.2820
 P  Y  A  N  H  E  L  K  E  E  N  R   | T  L  W  W  K  K  L  L      p.940

          .         .         .         .         .         .       g.43393
 CCTGAACTTTGTCAGAGAATAAAATGTGGTGGAGAGAAGTATCAACTCTACCTGTCATCA       c.2880
 P  E  L  C  Q  R  I  K  C  G  G  E  K  Y  Q  L  Y  L  S  S         p.960

         | 17.         .         .         .         .         .    g.47564
 TTAAAAG | AAACATTGTCAATTGTTGCTGTGGAACTAGAACTGAAGGATTTCATGAATGTT    c.2940
 L  K  E |   T  L  S  I  V  A  V  E  L  E  L  K  D  F  M  N  V      p.980

          .         .         .         .         .         .       g.47624
 CTCCCAGAAGATGGTACTGCAACATTTTTCTTGCCATATCTTCTCTATTGCAGTCGAAAG       c.3000
 L  P  E  D  G  T  A  T  F  F  L  P  Y  L  L  Y  C  S  R  K         p.1000

          .                                                         g.47639
 AAACCATTGACTTAA                                                    c.3015
 K  P  L  T  X                                                      p.1004

          .         .         .         .         .         .       g.47699
 aggtatcatttgaaaaataccataatggcatttgagactgaatttctaaaaattgaatgc       c.*60

          .         .         .         .         .         .       g.47759
 caaagtacaagtagaggagttttttattttatatatcacacacacacacacacacacaca       c.*120

          .         .         .         .         .         .       g.47819
 cacacacacacacatatatgatacaaatgctttcaggctgcttaccttaccgtgtagtgg       c.*180

          .         .         .         .         .         .       g.47879
 taactattcacttcttaatttatgacctcaatcaatttaattgtctagaatgtaaaaagt       c.*240

          .         .         .         .         .         .       g.47939
 ctttaagacataagaattcctcaaagaagccatacattttttaaggtggggattgacttt       c.*300

          .         .         .         .         .         .       g.47999
 tattccaaggaacaacatcagttcactgttgttggagacatgacaatcattttcatccca       c.*360

          .         .         .         .         .         .       g.48059
 agaacactttaaggaaacattttacaagtatgcttgaaagaatgtcactaactggtccag       c.*420

          .         .         .         .         .         .       g.48119
 aattttatcttcttgatttttccagatttctctatgtttttgagaaagatgttaatgttt       c.*480

          .         .         .         .         .         .       g.48179
 tgccatggtaaaagatttcaaacctcattttttttgttccttttcttgttacttttaaga       c.*540

          .         .         .         .         .         .       g.48239
 aaactcatgctctgtttctctgaatcaaatgaagtagaagtttacaaagctaactttctt       c.*600

          .         .         .         .         .         .       g.48299
 cttgtctagctattaacatgatttgtcaaatgcatgtttttttcagccaaagccttgttt       c.*660

          .         .         .         .         .         .       g.48359
 ccatttttgttgatgtgtactcttgctcttttagctagagtgtatgtgaaaataaagaaa       c.*720

          .         .         .         .         .         .       g.48419
 tacatcattgtattcacaaccatgtgtcttcatttataactttttgtttaaaaaattttt       c.*780

          .         .         .         .         .         .       g.48479
 agttcaagtttagttcattgatattatcctctgaatgcagttaaggctgggcagaaattc       c.*840

          .         .         .         .         .         .       g.48539
 tactcatgtgacatctgccacaggtctattttgaagcttttcttctaatggcaatgtttg       c.*900

          .         .         .         .         .         .       g.48599
 tccttaccaggatttaatctatagaattgtctctcaactctgcttttctccagttccaga       c.*960

          .         .         .         .         .         .       g.48659
 taacgtccttaagaccatctgttcaggggttcacaaaactcaaatttgtgtcattctatt       c.*1020

          .         .         .         .         .         .       g.48719
 ttatttattttattttttatttccttccctcataccttgcccattccctctgaatattag       c.*1080

          .         .         .         .         .         .       g.48779
 gtgtgatgtcaacagcatgttagaaggatcaatgggaaggcaatgattgaaaacatttca       c.*1140

          .         .         .         .         .         .       g.48839
 atgaaccttaatagtgttcctttgaggagcacccaggagaatatctggtcatagatcttt       c.*1200

          .         .         .         .         .         .       g.48899
 ttttaaatgcagttttataaaaccctaacagcggtgatatcattagactgtatgaatcag       c.*1260

          .         .         .                                     g.48935
 ttttattacctagtgtacaagtgtcagtcatgtatc                               c.*1296

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Hermansky-Pudlak syndrome 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center