Hermansky-Pudlak syndrome 5 (HPS5) - downstream reference sequence


         .            .         .         .         .         . g.48553
actgaacaattc / aactcttttttgcatttataacataaccagagaatatggacacaaatc c.*1260

         .         .         .         .         .         .    g.48613
actgttaaacttacacattactcctagatatgatgcaaccatatgggttaaagagattgt    c.*1320

         .         .         .         .         .         .    g.48673
cggctgggcgcggtggctcacgcttgtaatctcagcactttgggaggccaaggcgggtgg    c.*1380

         .         .         .         .         .         .    g.48733
atcacgaggtcaggagatcgagaccatcctggctaacacggtgaaaccccgtctctacta    c.*1440

         .         .         .         .         .         .    g.48793
aaaatacaaaaaaattagcctggcatgatggctggcgcctgtagtcccagctactcggga    c.*1500

         .         .         .         .         .         .    g.48853
ggctgaggcaggagaatggcgtgaacccgggagccggagcttgcagtgagccaagatcgt    c.*1560

         .         .         .         .         .         .    g.48913
gccactgcactccaggttgggcgacagagtgagactccgtcccaaaaaaaaagagagatt    c.*1620

         .         .         .         .         .         .    g.48973
gtcagggaaaggagaattcttagaattccgggaagtatggaaaaccttcccactagcata    c.*1680

         .         .         .         .         .         .    g.49033
atttgccttttggccatattggattgtgttgaaatgtgcatctatactgagataagggtg    c.*1740

         .         .         .         .         .         .    g.49093
agagcccctgtccactgtcagcacagtcactactagaaggcccagaggaagtcccgtgac    c.*1800

         .         .         .         .         .         .    g.49153
aagcagacagcatgaactggcacaattgtgcaatcatttcttcacagaccttctcaaggc    c.*1860

         .         .         .         .         .         .    g.49213
acagcaattctcatttgataaagggtatggagagaaatttctaatataacaaaaacaaat    c.*1920

         .         .         .         .         .         .    g.49273
cttgtcacttgaatttattttccgaggcaaacaaacaaaaatcaccttcatgacattaga    c.*1980

         .         .         .         .         .         .    g.49333
tgaaaaaaaaaatctccttcagttaaacatttaaacttgcagtctatttgggtattagtt    c.*2040

         .         .         .         .         .         .    g.49393
tttaaatagaacttgtatctttctttcgcttccctgaaagttctaggcagattgtgattc    c.*2100

         .         .         .         .         .         .    g.49453
atggttgcctcccttttcccttttgtttacagatctgaccggctgttttacagggcatca    c.*2160

         .         .         .         .         .         .    g.49513
cagtggctgagagcttgtgttctgaggctgactgccttggtttgaatatctactctctct    c.*2220

         .         .         .         .         .         .    g.49573
tttgcttcatgactttgggaagttcctttgtttttctaagttctagtgttctcatctgta    c.*2280

         .         .         .         .         .         .    g.49633
aaatggggatgatggtagctctgattcagggtattttgaggattagatgagataatagca    c.*2340

         .         .         .         .         .         .    g.49693
caaagaaagagttgaggtgttagagctcctttttagtgagaattaaaggagacggaaatg    c.*2400

         .         .         .         .         .         .    g.49753
gtagggcacagtgcctgtgatgtagcgtataggtaataatgttagctattgttagaaagg    c.*2460

         .         .         .         .         .         .    g.49813
tttgggatgtcgttgttggacctggtagttatcagacccatagacattggatttacatga    c.*2520

         .         .         .         .         .         .    g.49873
gccagagacagtgggaagacgaaaattgaaattaataatttccttgcatgtgttaaattt    c.*2580

         .         .         .         .         .         .    g.49933
gtgattgccctggtcaaggctcaaaaccttgtagtagtcatccttgcctcttcctcctcc    c.*2640

         .         .         .         .         .         .    g.49993
tctaccctcacttctaatgactaggtacatttctaccttgctttcaattctaccttgctg    c.*2700

         .         .         .         .         .         .    g.50053
gtgttttccattagtcatttttttcccattgtctcttgccaccagctcacgttctcatta    c.*2760

         .         .         .         .         .         .    g.50113
tttcttgcctagactattgccacagtcttttttttttttttttttttttgagacggagtt    c.*2820

         .         .         .         .         .         .    g.50173
tcgctcttgttgcccaggctggagtgcaatggtgtcatctcggctcacagcaacctccgc    c.*2880

         .         .         .         .         .         .    g.50233
ctcccaggttcaagcgattctcctgcttcagcctcctgagtagctgggattacaggcatg    c.*2940

         .         .         .         .         .         .    g.50293
tgcaaccacacccagctaattttgttgttgtttttatttatttattattatttttagtag    c.*3000

         .         .         .         .         .         .    g.50353
agatggggtttctccatgttggtcaggctggtctggaactcccaacttcaggtgatccac    c.*3060

         .         .         .         .         .         .    g.50413
ctgccttggcctcctaaagtgcttggattacaggcgtgagccactgcgcctggcccatta    c.*3120

         .         .         .         .         .         .    g.50473
cagcagacttaagtgaccttcctctcttcacctctaaccactgacatcccatcactgcca    c.*3180

         .         .         .                                  g.50505
ccagttcatctcagcacaataaatgtaaacaa                                c.*3212


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center