Hermansky-Pudlak syndrome 5 (HPS5) - 4038 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5289
gtagtagttccactaggcaaggagctttttgtgggtagggattgtgttttgttcatccct  c.-50+60

         .         .         .         .         .         .  g.5349
gtgtctctagcggtgtgttcaggtcctggaacatagtaggcactcagaatgttgaatgaa  c.-50+120

         .         .         .         .         .         .  g.5409
tgaatgtataaatgagtcagtcgccatttgtctgaggcagagagttgttttctgatcatt  c.-50+180

         .         .         .         .         .         .  g.5469
tcttcttggatagaaagatcccattgtgaaaatgaggcagtctgcaacttccccttctca  c.-50+240

         .         .         .         .         .         .  g.5529
tttcttcaatttttgctatctttcttacttctttctcctcttcctccacgcacctactgg  c.-50+300

         .         .         .         .         .         .  g.5589
ggcaaaagagaaacatgtttgcatttgatgtgtgagcaacaaacactgaactattttacg  c.-50+360

         .         .         .         .         .         .  g.5649
ataatggaaagatgagatttggattcaggagacgcgtattctaatctcagctctaccatt  c.-50+420

         .         .         .         .         .         .  g.5709
tatgaactctgtgatccttgggcaagccagtctcccaaaagttgtttcatttactttggt  c.-50+480

         .         .         .         .         .         .  g.5769
taagcatttgtcgccaacttctatgttcttagtttttggtagagtgccttcacagaagta  c.-50+540

         .         .         .         .         .         .  g.5829
acatttaaactcagctttgcagaaaggtagggttttggtaaatgggggaagattccataa  c.-50+600

         .         .         .         .         .         .  g.5889
acatcatatattaaaccatggaggcacagcaagtttatggaatgaaaaagaaaaaaagag  c.-50+660

         .         .         .         .         .         .  g.5949
tcgagtccaatgtagttggagaatagagaggttaagatgggaaataaggctggaaaaaga  c.-50+720

         .         .         .         .         .         .  g.6009
agcagggaggagataacagattttcaagaaatagagctgttgaaggcttgtacaatatta  c.-50+780

         .         .         .         .         .         .  g.6069
tgtatatattttttaaattttattgtggaaaatttcaaacgcagacaaaagtaggataat  c.-50+840

         .         .         .         .         .         .  g.6129
aaattgaaccctcatgtacacttaacgcaacttgaacaattatcagcattctgctgttcc  c.-50+900

         .         .         .         .         .         .  g.6189
tctttatactgtttgtacatttctaggtactttttatatccattgttgcatttgattaat  c.-50+960

         .         .         .         .         .         .  g.6249
agcagctttcaatttgagctcagttctactgtatgtagctactggctaagaagattttat  c.-50+1020

         .         .         .         .         .         .  g.6309
ttatgtaaacaatttctttgggttttagttgaccacttgctctgttgaatcaatgtgtaa  c.-50+1080

         .         .         .         .         .         .  g.6369
catggccacttaaacacaactaatactgtttttaggttgtaatatagaaacttagtgtct  c.-50+1140

         .         .         .         .         .         .  g.6429
agatccaggaagttagtgtttctactctattctgggctcatctaactacttaaggagtat  c.-50+1200

         .         .         .         .         .         .  g.6489
tatgctcagttctaggcacctcatttttaggcaaactacagtgcctctgtagaaggttga  c.-50+1260

         .         .         .         .         .         .  g.6549
ctggaacagagggttggaaaatgtcatgtcaggagtgatgaagaaactgggaatgttaaa  c.-50+1320

         .         .         .         .         .         .  g.6609
tttttagaagacctgataatgcttttcaaatacagaaggattgttttggaaagagacagc  c.-50+1380

         .         .         .         .         .         .  g.6669
ttgttcccttcagctgtagaagctacatacaattaggaataatggtagagctctaagtga  c.-50+1440

         .         .         .         .         .         .  g.6729
tcaggcttcagcatagtattaaaaagaaccttataatagtgagccctttggaggactgga  c.-50+1500

         .         .         .         .         .         .  g.6789
attggcagcttcatgagagtgagtgctttctttccatggctgaaaatgttcagggatcta  c.-50+1560

         .         .         .         .         .         .  g.6849
gggcaaaactaatttctgaattaggtggacatgttcactgaattacctatgaatcttttt  c.-50+1620

         .         .         .         .         .         .  g.6909
ccatcttgagaattctaggaagtagggctcatgtgcgatcttgaaagctgggtatgtttg  c.-50+1680

         .         .         .         .         .         .  g.6969
gataagaaaatctggaagggaagcagtcatttcagggagagtaaacataaagtataaagt  c.-50+1740

         .         .         .         .         .         .  g.7029
tgaagttggtttaacactgtcattcagcagcttctctgagaattggcattgcttatgctg  c.-50+1800

         .         .         .         .         .         .  g.7089
tttttattttccattctcatttctgttaaattctttttttcttttcagtagaacttacta  c.-50+1860

         .         .         .         .         .         .  g.7149
ggtgtgtccccctgcacacccccgcattatattataacttccaggacattctctttttac  c.-50+1920

         .         .         .         .         .         .  g.7209
cgagattaaggcaaaatgacctactcagagtttctttgtttcaagatcacaagtagaaga  c.-50+1980

         .         .         .           g.7248
gacactatgatattatcattcctttccatctcttggatc  c.-50+2019

--------------------- middle of intron ---------------------
         g.7249               .         .         .           g.7287
         c.-49-2019  ctgtaccatggttttatctttttcttgaatcttcagtcc  c.-49-1981

.         .         .         .         .         .           g.7347
ctttcgttctagactctacttttagctactacctacaaatctgttgaagagtctccccaa  c.-49-1921

.         .         .         .         .         .           g.7407
taataacgtcaagagaggttttctccttttccaccagacttcttgagtaattgaaatgtt  c.-49-1861

.         .         .         .         .         .           g.7467
ttatcctcattttcatatcacccacccgttttctcaagtctttgttttctagcatctaac  c.-49-1801

.         .         .         .         .         .           g.7527
cacccacagcactttacagaaattgtgtgacctcccaacacacaattcttcaattccttt  c.-49-1741

.         .         .         .         .         .           g.7587
ctgttgcctgccaagttaagttcaggttctttggtttgaaattcaaagtgttttgtaact  c.-49-1681

.         .         .         .         .         .           g.7647
tgggcccaaattaagattccagctttatctttcattattccgttgcttgtatcctgtttc  c.-49-1621

.         .         .         .         .         .           g.7707
aaccaaagactaaatttgtattcttctagtatattctgcatttttttcttctctatatat  c.-49-1561

.         .         .         .         .         .           g.7767
ttgcttattgctaccctacctgctaccctttcccttttccttgagataaaagcctagtca  c.-49-1501

.         .         .         .         .         .           g.7827
gcatcagtactactttccttagagcgttttcttcagttccctttaattcaatgtgatccc  c.-49-1441

.         .         .         .         .         .           g.7887
tctgtcctgtaaagttctaacaaagcagtttgcttatgtttcccttataagatgtgtgtg  c.-49-1381

.         .         .         .         .         .           g.7947
tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtggtatttgtcttttcctccgtattataaa  c.-49-1321

.         .         .         .         .         .           g.8007
ctgactgacttctggaattattttacttgtcttatttttaccactgtgcctggtacttta  c.-49-1261

.         .         .         .         .         .           g.8067
ctaggtactcaatgaaatgaatgagtgaaaacaatgagggaagattttcttaggtcaata  c.-49-1201

.         .         .         .         .         .           g.8127
attctcaaatattttgagtacaggcatgtgaaagtttctttctgggttttttcttttttt  c.-49-1141

.         .         .         .         .         .           g.8187
ttttcctgaacattctccttgcagaggtcaaggtgtattaggaacagtgttactagcaga  c.-49-1081

.         .         .         .         .         .           g.8247
aaataagattgtgttatgtgtgtgcaataaaaaatatagtcttcgttttgccactagaaa  c.-49-1021

.         .         .         .         .         .           g.8307
gtatgctctatgagggttagaactttatcatctccaggacctagaataatgtctggcacg  c.-49-961

.         .         .         .         .         .           g.8367
taggtgggtgctcagtacaaatttgttgaataaatgagtgatggaatatatatgtttctg  c.-49-901

.         .         .         .         .         .           g.8427
gaaaaaaagtcaaaaacgtaaagcatgaacaaacaacaagaatgtataaacagttcatga  c.-49-841

.         .         .         .         .         .           g.8487
ctttttctgttgtattcattggctttctaaatttggcaggtaacaagtgattgagaaaag  c.-49-781

.         .         .         .         .         .           g.8547
ttataattaatgagtagaattttcttttctttttttctggagattggtgcaagttgacaa  c.-49-721

.         .         .         .         .         .           g.8607
aaaagtgcatttgagagtaggtgaacacataaaaactttcgtgttactttacaaagtcct  c.-49-661

.         .         .         .         .         .           g.8667
cactggttatttggcatttgttaccttgtattcttatccgtattctgtcctatctagtct  c.-49-601

.         .         .         .         .         .           g.8727
cttttgttgaagcgcttatttttctttgtgctctaattccctgtaccttctcacttagta  c.-49-541

.         .         .         .         .         .           g.8787
gatctgttcattcattcaccatacttactaagcccctgctcggttgaagagagaagtcta  c.-49-481

.         .         .         .         .         .           g.8847
gtggcctattcctataaaccactgttaaattgttagctgataactgtagggtttgctgat  c.-49-421

.         .         .         .         .         .           g.8907
aacagttaataagttgaggcctttacagaagattgcgttttaatgagagactcctaaaga  c.-49-361

.         .         .         .         .         .           g.8967
cagaagatttagtattcatagaaatgcagcagcaaggttgctgttttaactcagggtgat  c.-49-301

.         .         .         .         .         .           g.9027
atgccaattttcctaaatcctactctacctattctgtttactcacactgttagataatac  c.-49-241

.         .         .         .         .         .           g.9087
agggggataggcttatggagggccctgagaatccgtacctgctactctgggagttttaga  c.-49-181

.         .         .         .         .         .           g.9147
gtcagggaatgacacaatgtaaacacactgtggcatacgatgttaccttatgtgttttct  c.-49-121

.         .         .         .         .         .           g.9207
ttctaagtccctgtatagtggggactttctcatgtttctctatgttccccacatatttgt  c.-49-61

.         .         .         .         .         .           g.9267
taaatgcatgttaaatgaatggtgggcttcttaaattatatttttgtggattttattcag  c.-49-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center