Hermansky-Pudlak syndrome 5 (HPS5) - 462 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.15321
gtaagattaagggcagctctgtcatacaccatttggagtctctttcataaatgcaaattt  c.219+60

         .         .         .         .         .         .  g.15381
ctccaatataaataatcatttggaataaaagaatgtagaacttggcttggtgcggtgtct  c.219+120

         .         .         .         .         .         .  g.15441
cacgcctgtaatcccagcattttgggaggccaaggcggatggattacctgaggtcaggag  c.219+180

         .         .         .         .         .   g.15492
ttggagaccagcctggccaacatggtgaaaccccgtctccactaaaaacac  c.219+231

--------------------- middle of intron ---------------------
       g.15493     .         .         .         .         .           g.15543
       c.220-231  aaaaattagctgggcgtggtggtgagtgcctgtaatcccagctacttggga  c.220-181

.         .         .         .         .         .           g.15603
ggcggaggcaggagaatcgcttgaacccaggaagtggaggttgcagtgagccgagatcgc  c.220-121

.         .         .         .         .         .           g.15663
accattgctccccagcctgggcaacagagcgagactcagtctcaaaaaaaaaaaaaaaaa  c.220-61

.         .         .         .         .         .           g.15723
taataataataataatgtaaaacttgagatttaaaaaatgtattttcttttgtgctctag  c.220-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center