Hermansky-Pudlak syndrome 5 (HPS5) - 453 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.15848
gtaagaatctgttccaaaactatctgtcctttttcaaatgcattttaaattgacacatgt  c.284+60

         .         .         .         .         .         .  g.15908
gtttgttagggtgaccaaccatcctggtttgcctaggattgtcccggttttaacagtgaa  c.284+120

         .         .         .         .         .         .  g.15968
actcctgtgtctcaggaaatctctcagtacccagcaaaccagaatggacagctggtcatc  c.284+180

         .         .         .         .         g.16015
ctagtatttgtagaaaatgctaatttaaggttacaacatttcaaagg  c.284+227

--------------------- middle of intron ---------------------
   g.16016          .         .         .         .           g.16061
   c.285-226  ccttaaaagataaagggaacagagataatttagatcatttaacttc  c.285-181

.         .         .         .         .         .           g.16121
tcctattaaactggtttggtgactaaaacaaggaaattaataccttgactttttataata  c.285-121

.         .         .         .         .         .           g.16181
cttcctcttttctgaagaacaagagttgcatatgtatttgatatagttgatactgtgatg  c.285-61

.         .         .         .         .         .           g.16241
caacaaaattgtaccttgttcactgttgccacgtttgcctctgtgactcaattcttgcag  c.285-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center