Hermansky-Pudlak syndrome 5 (HPS5) - 1661 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.16494
gtgagaagcagtcccattctttgtgtatgtagtgagatacaaggtgttgtcttataaaac  c.477+60

         .         .         .         .         .         .  g.16554
ttccaattaaaggatgtgattttatctactgtatttcttgggagactaatccggagtcca  c.477+120

         .         .         .         .         .         .  g.16614
aacctggagattttgaggagacctgtttttatatagtacacacggtggcctgttagctca  c.477+180

         .         .         .         .         .         .  g.16674
ataccgttacagaatggcttttgtgaactaacttcagtactttgcacattatctattgca  c.477+240

         .         .         .         .         .         .  g.16734
gtccttcctgattcacctgcatggctcatttaaagcattctttagtataaggctattaag  c.477+300

         .         .         .         .         .         .  g.16794
aaagaaaagatatctatttattattggtgtgaataaagtgacaaacatagaaatgacacc  c.477+360

         .         .         .         .         .         .  g.16854
aattgcccaggcttctggtcttctctgcttcttgtgtagaagaaactcataggtctagga  c.477+420

         .         .         .         .         .         .  g.16914
atattttttatcaggatggatataacttattttgaatggaatcttgaagacaccttctgg  c.477+480

         .         .         .         .         .         .  g.16974
ctttgctctgctctgcaggtcctcaggcttcttgctgcagttatggctaagtagaagggt  c.477+540

         .         .         .         .         .         .  g.17034
tgagactcaggttaccctaacagaatgctccagtctgtcattaagacagaatagaccagc  c.477+600

         .         .         .         .         .         .  g.17094
ttctcattgtcctgctcctccacgaccattacatcagaagtagagggatttgtcttgcat  c.477+660

         .         .         .         .         .         .  g.17154
tggcttatttctatttaggatcctggcagaaaagaaaggctctaactactattggctaaa  c.477+720

         .         .         .         .         .         .  g.17214
tttattttattttattttgagacaggttcttgctctgtcactcaggcagaagtacagtgg  c.477+780

         .         .         .         .         .   g.17265
tgagatcatggctcactgcagtcttgattgcccaggctgaagcaatcctct  c.477+831

--------------------- middle of intron ---------------------
         g.17266    .         .         .         .         .           g.17315
         c.478-830  cacctcaaacctcctgagtagctgggactactggcatgcatcaccacgcc  c.478-781

.         .         .         .         .         .           g.17375
tggctaatttttaaaaacttttgtagagacagggtttcgccatgttgcccaggctggtct  c.478-721

.         .         .         .         .         .           g.17435
cggactcctgggctcaagtgatccaatcaccttgccctcgcaaagtgctgggattacaga  c.478-661

.         .         .         .         .         .           g.17495
catgagccactgcgcctggctattggctaaattattttattttaatgaacacatcagaat  c.478-601

.         .         .         .         .         .           g.17555
atttttctggtttgccgtcatgacctatcaacgttatcaattgattcttaatatattttg  c.478-541

.         .         .         .         .         .           g.17615
gacctaaaatatagaaaccctagtaaacttattttgtctttttctaaaagggagaagtgc  c.478-481

.         .         .         .         .         .           g.17675
tatctacaggtgaaaaattctttcacatactccaaaactttatttatctagagacaggtt  c.478-421

.         .         .         .         .         .           g.17735
cttcttctgttgcccaggctggcatatagtagcatgatcttagctcactgcagcctcaag  c.478-361

.         .         .         .         .         .           g.17795
ctcctaggctcaagcagttcttctgcctcagcctcccaagtagctgggattatggatgtg  c.478-301

.         .         .         .         .         .           g.17855
tgctaccatgcctgactaacatgttctaaaccttgcttcatctttttcgttctaacctct  c.478-241

.         .         .         .         .         .           g.17915
aagattagataatcacaaacagatccttgagaaatctcttctgcagttacgtaccagatt  c.478-181

.         .         .         .         .         .           g.17975
atttaatacaacttttaagtgactaaaactttgatatccttacaagcaaattaagttttg  c.478-121

.         .         .         .         .         .           g.18035
gcttatttgaaaattttattttgctattcaagttattttcatttacaaggtaaagaggaa  c.478-61

.         .         .         .         .         .           g.18095
gagattgcatgtgtatgttatgattaaataaactttatttctttctcacattccttttag  c.478-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center