Hermansky-Pudlak syndrome 5 (HPS5) - 2598 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.18289
gtatattgaccaaccattagtcatcagaaatgcagaattttagaactgggaggaacttag  c.611+60

         .         .         .         .         .         .  g.18349
aagttatctaccccaagccccatcaatcagttatacagattttttttctttttctttttt  c.611+120

         .         .         .         .         .         .  g.18409
ttctttttttgagatggggtctcactctgtcactcaggctggagtgcagtggtgtgatca  c.611+180

         .         .         .         .         .         .  g.18469
tggctcactgcagccttgacctccctggctcaagcgatcctcctacctcagcctctcaag  c.611+240

         .         .         .         .         .         .  g.18529
tagctaggtctataggcacatgccaccatgccctgctaattttttgtattttgtttagag  c.611+300

         .         .         .         .         .         .  g.18589
actgggttttgtcatgttacccaggctggtcttgaactcctgggctcaagcaatcttcct  c.611+360

         .         .         .         .         .         .  g.18649
gcctcagcctcccaaagggcttggattataggcatgaaccactgcccctggctatacaga  c.611+420

         .         .         .         .         .         .  g.18709
tgttaaggaatcagttgtatgcaagctgatgttagagagcagagaggaggtagaggagtc  c.611+480

         .         .         .         .         .         .  g.18769
taagacagtccagtgggtgactaagacaagtattccgtgagcccgttgctggtgagacat  c.611+540

         .         .         .         .         .         .  g.18829
attctaagtgccatgagagaaggctaaaggcctgtttttagatgggaaagcaggaagtct  c.611+600

         .         .         .         .         .         .  g.18889
tctttgagttttgttgttttcaagatttgttttattttaatagaattttactaaagggta  c.611+660

         .         .         .         .         .         .  g.18949
aaattggatgaaaaataattaagagctttatgaagataagtatttcatcaaaatctcaag  c.611+720

         .         .         .         .         .         .  g.19009
ggtagatagagccagaggtacaatgaatggcaaaggagtgcattagaggtagctgtgaaa  c.611+780

         .         .         .         .         .         .  g.19069
taccagagcagaatagcagacagctggaaatgaatattatgcatcactatgccaaagttc  c.611+840

         .         .         .         .         .         .  g.19129
tcagccattctcactgcaaggaaattttcactggccatttctttttttcactgggcctgg  c.611+900

         .         .         .         .         .         .  g.19189
cagctatcatatttctcaggaccatctccttttaaaaatttatcatggagagttttgagc  c.611+960

         .         .         .         .         .         .  g.19249
ctacacaaaagaagggagaattgtgtaatcaacacctgtgtacctatttcataactaaag  c.611+1020

         .         .         .         .         .         .  g.19309
ttggatgacagtatcatagaacctcctgtaaaaataacatgtttagacgtgctttctgtt  c.611+1080

         .         .         .         .         .         .  g.19369
agctagaattcagcttttggggacatgtgtaatataataaaatatatacttatgttaaaa  c.611+1140

         .         .         .         .         .         .  g.19429
aatctttttgtttcaacctgttttccctcccaacaaacagttttttggttttttttgttt  c.611+1200

         .         .         .         .         .         .  g.19489
ctttgtttttttttttaaagctgagactcctagtgactagccaaagtgatagatatgact  c.611+1260

         .         .         .           g.19528
ttgcttcatgtaaatttagtgttaaggattaactaaggt  c.611+1299

--------------------- middle of intron ---------------------
         g.19529              .         .         .           g.19567
         c.612-1299  agcatatgtgaaaatactcaactttgtgcctgtgacgta  c.612-1261

.         .         .         .         .         .           g.19627
ttgtttgaaaaataatagaaagtaagattaatgagtatacaaatgataatgaattgatta  c.612-1201

.         .         .         .         .         .           g.19687
catttttcactcagcaaacatttattatgttcctccagctccttagcactgtattaggta  c.612-1141

.         .         .         .         .         .           g.19747
ccatagaaaatataaaatgaagaaatatattttatttcccaaataaggagtataagtaat  c.612-1081

.         .         .         .         .         .           g.19807
aaaaccactacttcctgtacagctctgtatacatttcaaagcactcttacacctatgttc  c.612-1021

.         .         .         .         .         .           g.19867
ttaaagtaaagcaaatgttatattttattcataaagcaattaagtacagaagtagttatt  c.612-961

.         .         .         .         .         .           g.19927
gaattatctgaggttaactagtaaattcatgctagagagcatattagatcactcttcaat  c.612-901

.         .         .         .         .         .           g.19987
aaaagagattgagtttatggaactctataatgtattgagtgctttttgtaggcctgacac  c.612-841

.         .         .         .         .         .           g.20047
tgtgctacacactgggaattcaaccaaagaggaataagaattgtcctttgccttgaaaag  c.612-781

.         .         .         .         .         .           g.20107
tcatgatctgctgtttaaatagacataattgccatatatcatgtcataagtgctatgaaa  c.612-721

.         .         .         .         .         .           g.20167
gcaaagcataggaagcgtgtaattccatatatgggaatcaaggaaagtttctgaggagga  c.612-661

.         .         .         .         .         .           g.20227
atgataagtttctgaggaggaatgatggaatcatggagagtaagtaacaggagtttttag  c.612-601

.         .         .         .         .         .           g.20287
gaagagacatctccctcatcattatcaccttccgtgttcccaggcagtgtactaagctct  c.612-541

.         .         .         .         .         .           g.20347
tttatatatctaactcatgtaatcctaagggaacagaatgctccaaggtgcagagtttca  c.612-481

.         .         .         .         .         .           g.20407
gaaggacctgggtttttgaggaaaaagtaagtttattgggtgtttgtggtgaggaagtga  c.612-421

.         .         .         .         .         .           g.20467
cttggagacagggttggagaactagattagtagcttccatggagtgtccaaagaacattt  c.612-361

.         .         .         .         .         .           g.20527
tacaaagtgactttagaagcaattagtaggattcaaggatgtacgaaatagtttggtagc  c.612-301

.         .         .         .         .         .           g.20587
actcaccttttagatttggaaggggcctttacattaattctgagcctcttattctgtgga  c.612-241

.         .         .         .         .         .           g.20647
taataaactgagtactaatatgaaatgatttgcttcctgtcatagaaatagctaatggca  c.612-181

.         .         .         .         .         .           g.20707
atcagagccagaatcctattttgatctttccattctattgtttttttcagtatattgcta  c.612-121

.         .         .         .         .         .           g.20767
atatgaatgaaggagaaggcattgtgagtggagttattatgcccatgctgatttgtagtg  c.612-61

.         .         .         .         .         .           g.20827
ccgttgtttttgacttttttttgtaagtaaatctgctttctcttcctttctggatgttag  c.612-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center