Hermansky-Pudlak syndrome 5 (HPS5) - 641 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.21100
gtaacgatttgtatggctggttgggattgtttgaagagcttctatatagaggttcggtga  c.824+60

         .         .         .         .         .         .  g.21160
aaatctctgatattctatctgtgttaaagattttattatacctggctgggcgtgttggca  c.824+120

         .         .         .         .         .         .  g.21220
cacgcctgtaatcccagcactttgggaggctgtggcaggcggatcttgaggtcaggagat  c.824+180

         .         .         .         .         .         .  g.21280
cgagaccatcctgactaacgcggtgaaaccccgtctctaccaaaaatacaaacaaaattt  c.824+240

         .         .         .         .         .         .  g.21340
agctgggtgtggtggcgcatgcctgtagtcccagctactcgggaggctgaggcaggagaa  c.824+300

         .         .   g.21361
tggtgtgaagggaggcggagc  c.824+321

--------------------- middle of intron ---------------------
                             g.21362    .         .           g.21381
                             c.825-320  ttgcagtgagccaagattgt  c.825-301

.         .         .         .         .         .           g.21441
gccactgcactccagcgtgggtgacagagcgagactccgtctcaaaaaaaaaaaaaaaaa  c.825-241

.         .         .         .         .         .           g.21501
agattttattctatcttttcagagtgaagttggatttttatttttattaaaagattcaga  c.825-181

.         .         .         .         .         .           g.21561
aaaaccaaagaagtctttgataattacctctcctatgattagtgtcaggcgaataagggc  c.825-121

.         .         .         .         .         .           g.21621
agatgcagttaggctcttgaatttgttttggaggcaaaaatttccctatattgggaaaag  c.825-61

.         .         .         .         .         .           g.21681
tgtaattttatgttatacttttaacagataaactcattaacagatgtgtttactttctag  c.825-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center