Hermansky-Pudlak syndrome 5 (HPS5) - 4505 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.21813
gtaagtttctactttccttagttctgggggggaaaaagaatacttagatttttatctctg  c.896+60

         .         .         .         .         .         .  g.21873
tttcttgttcagaagtagttttttaaggttatttttgcactaaattacttatagaaagtt  c.896+120

         .         .         .         .         .         .  g.21933
aggaaataattatgttacatgaagtgttctgtatctaaaaggaatggaaagatcctagaa  c.896+180

         .         .         .         .         .         .  g.21993
atacacttctctttccaagccaattggagagtttataattgccaagaaacttctaacaat  c.896+240

         .         .         .         .         .         .  g.22053
tggagctaagatagctctactaaccgcctcataacctctcctacctaatgggatgctata  c.896+300

         .         .         .         .         .         .  g.22113
atgaaagcaagtcccagatcaaaatctgccacacagatgtatgtgtttttagcaagcagg  c.896+360

         .         .         .         .         .         .  g.22173
cacaaaaatagttgtagaacttgttcttgtaagcttggtgaaatttcagctctctatcct  c.896+420

         .         .         .         .         .         .  g.22233
ataggtactctgacaaatgcttgcatgaaagatctgctggaggcagtttcagccatattc  c.896+480

         .         .         .         .         .         .  g.22293
taatgtcagagttcagccagccttctagttggattaggtgcaaagtccagcacaaagtgc  c.896+540

         .         .         .         .         .         .  g.22353
tgccctaaaagttgttaaactgctggacctgccaattcttacaccttgttctgcaagagc  c.896+600

         .         .         .         .         .         .  g.22413
aagagtaccagtgtatgatttccagccaatatcttgaactctatttcatcaataaaaaat  c.896+660

         .         .         .         .         .         .  g.22473
tacttctgatatcccttaggctagttaacaagatctctgatgcaaattcagcaaatattg  c.896+720

         .         .         .         .         .         .  g.22533
tatgaagttgtcatatggtacactggagtgtgaacacctgattcagttctttgaaaggct  c.896+780

         .         .         .         .         .         .  g.22593
aactaaccactctttgtgatttttaaaaataattgaagtgttaactaattgcctctaagg  c.896+840

         .         .         .         .         .         .  g.22653
gtaaggataaaaaccagttcatgtatttgtcatacttcctacactgaagtatttaaaagt  c.896+900

         .         .         .         .         .         .  g.22713
gaattataaggccgggtgtggctcatgcctgtaatcccagcaatttgggagaccgaggcg  c.896+960

         .         .         .         .         .         .  g.22773
gacagatcttctgaggtcgggagttcaagactagcctatcaacatggagaaaccccgtct  c.896+1020

         .         .         .         .         .         .  g.22833
ctactaaaaatacaaaaattagccaggcatagtggcatgctcctgtaatcccagctagta  c.896+1080

         .         .         .         .         .         .  g.22893
gggaggctgaggcaggagaatcgcttgaacctggaaggtagaggttgcagtgagccgaga  c.896+1140

         .         .         .         .         .         .  g.22953
tcgtgccattgcactccagcctgggccacagagcaagactctgtctcaaaaaaaaaaaaa  c.896+1200

         .         .         .         .         .         .  g.23013
aaaaagtgaattatagacattataacactttagtaactccataattcttcatgaaagtta  c.896+1260

         .         .         .         .         .         .  g.23073
ctagagaaagacatttatttatttacccataattagataaagcatattaaaaactcttcc  c.896+1320

         .         .         .         .         .         .  g.23133
tcctttagcattcttcctttgtggcacttgtcacagtttataattacatattaatataat  c.896+1380

         .         .         .         .         .         .  g.23193
atttatacatgtcttaccctaaacagtaagctccatgagggctttatttctgttttgttg  c.896+1440

         .         .         .         .         .         .  g.23253
actattattttttcaatgcttggcctaatgcctggcacatgatagatacttaataaatat  c.896+1500

         .         .         .         .         .         .  g.23313
ttgttgactatgatgtgatgtgcggggtattgggaagtcccttacccaagtttttttttt  c.896+1560

         .         .         .         .         .         .  g.23373
tttttttagagacggagtcttgctctgtcacccacattggagtgcagtggtgcgatctta  c.896+1620

         .         .         .         .         .         .  g.23433
gctcactgcagcctctgcctcccaggttctagcaattctcctgcctcagccttccaagta  c.896+1680

         .         .         .         .         .         .  g.23493
gctgggactcacaggcgcacgccaccacgcctggctaattttttgtattttagtagggat  c.896+1740

         .         .         .         .         .         .  g.23553
ggggtttcaccatgttgcccaggctggtctcgaactcctgagctcaggcaatccacctgc  c.896+1800

         .         .         .         .         .         .  g.23613
atcggcttcccaaagtacccaagaatatgttttctagtagtcgggccacaatacacttag  c.896+1860

         .         .         .         .         .         .  g.23673
ctctcctggtagagttattcttttggctgtagctatttaaagctgctgttatagtcccta  c.896+1920

         .         .         .         .         .         .  g.23733
ccatggtagacaaaaagcctttgatgatctggctctgcctattcctcagctaaagcaaca  c.896+1980

         .         .         .         .         .         .  g.23793
attaacgccactttgaaacttctgctgattcctcaaagaggcttacgttagacaacctat  c.896+2040

         .         .         .         .         .         .  g.23853
ttctgtgcatgtactgttgtcaaaccatattcattcctttatcattgccactgtcttact  c.896+2100

         .         .         .         .         .         .  g.23913
gtattatgagtatgcatcccagcatcagattgtcaactccttttcatgggcagtgctaga  c.896+2160

         .         .         .         .         .         .  g.23973
cacatagaaaaccctcaaatgatagtgaattcaacaaagagttttttcgaaaacatgaag  c.896+2220

         .         .         .     g.24006
aggagggcttcttttcattcctgtttgtttatg  c.896+2253

--------------------- middle of intron ---------------------
                g.24007       .         .         .           g.24038
                c.897-2252  tttttcattcgtacactgtgccctatgggact  c.897-2221

.         .         .         .         .         .           g.24098
tttactgttgcaacccataaatcccagagggggcatccttatgtactttgtttcctttca  c.897-2161

.         .         .         .         .         .           g.24158
ggcacattcctttctggaacttctaaaacaatgctgttaggcttatgtccccatttatta  c.897-2101

.         .         .         .         .         .           g.24218
tcagtgaagggataaggggacaaggaatgtataaattacaagtatcagcttttatctaag  c.897-2041

.         .         .         .         .         .           g.24278
ttcccgtcctcagccccccatctaatctaggttgctattcctaaggaattttccaagctg  c.897-1981

.         .         .         .         .         .           g.24338
aatgtcaggttcagtatcaaaattatgatcctgtatctctttctcagggatcctctgaca  c.897-1921

.         .         .         .         .         .           g.24398
ccccccccccccccgctttttttctcctttgactcttgaaggcagccttctcaattttac  c.897-1861

.         .         .         .         .         .           g.24458
tttggattcagattctgaccatttcttgcattttatgacaaagattactttcctgtaggg  c.897-1801

.         .         .         .         .         .           g.24518
atagtgatctggtctttcatattgacaaaatgtttaacacttacatgagggcccaactcc  c.897-1741

.         .         .         .         .         .           g.24578
tgttaaaaatcaattagtttcatagccacatggaaccatttttagtactcttggaaacat  c.897-1681

.         .         .         .         .         .           g.24638
aaaggaaaaagaaatatagtccctgttcttcagagtataatttattagagagatatgatt  c.897-1621

.         .         .         .         .         .           g.24698
tatttgtccaaaaagtttaacaacaataagaagtaagagttgtgacagtgcagtagatga  c.897-1561

.         .         .         .         .         .           g.24758
ttaagtgccatatgagcagagtataagaaataggttgagtgcaagaaatagggtgagtgt  c.897-1501

.         .         .         .         .         .           g.24818
tgtgggctgtaagggaggatttcagagggaagtagaacttctgatccttgagaggtggct  c.897-1441

.         .         .         .         .         .           g.24878
agattaagaacattgtaagttggagaatgtcctgaacagcattaggaagtggagattacc  c.897-1381

.         .         .         .         .         .           g.24938
agtggtatataaaaaatagtagcagccttgagagaataaatgaaatatatgagataaatt  c.897-1321

.         .         .         .         .         .           g.24998
tatatgagtaagtatagaaaaagatgaggagaaaaaaatgagtcctccagaccagaggac  c.897-1261

.         .         .         .         .         .           g.25058
tggagagaaagagaaccaagaaaatgcagtgtccaggagccccaggaggtgaggttcaag  c.897-1201

.         .         .         .         .         .           g.25118
aagcagagaacagttagcagggttggcttctgcttggggttaagaaaatgggaagtgatg  c.897-1141

.         .         .         .         .         .           g.25178
aagggttattgggtttggcagtttgggaatctgtgactttttgagaattcagttaagtgg  c.897-1081

.         .         .         .         .         .           g.25238
aatagttaggattccagataatagtgagtaggttagtgaagataagtggaggaggaagta  c.897-1021

.         .         .         .         .         .           g.25298
gattctgtgttatataggaaaaaagtccaggttttggagccagactatcctgcatatcca  c.897-961

.         .         .         .         .         .           g.25358
gtataaattctgactcgtatacatttcatgctgaatggcctttggtatattattttattt  c.897-901

.         .         .         .         .         .           g.25418
ctctgagccttagctttttctctttttaataagaatagtatatctaccttgactggcttc  c.897-841

.         .         .         .         .         .           g.25478
tacaaagttaggtaatatagacagagcctttaataaagctcctggcacatcgttgagcag  c.897-781

.         .         .         .         .         .           g.25538
gagttgtcagctttttgttgcgcacacacaactaacaacatcaaaatattactgttctta  c.897-721

.         .         .         .         .         .           g.25598
aaagtgtctcactagagtaatgattggcagtaagatgttagtctttgttttaaatgtgcc  c.897-661

.         .         .         .         .         .           g.25658
cgtatcatgtccagtatggaaagttcagctgctttaacgaacatcaggtaaaggtcccta  c.897-601

.         .         .         .         .         .           g.25718
agcttttctttttccagataccagccttttctttctttcttttttttttttttttttttt  c.897-541

.         .         .         .         .         .           g.25778
ttgagacagagtcacccaggctgtcacccaggctggagtgcagtggcacaatcttggctc  c.897-481

.         .         .         .         .         .           g.25838
actgcaacctccgcctccctgtaagtgattctcctgcctcagcctcccgagtagctggga  c.897-421

.         .         .         .         .         .           g.25898
ttacaagcgcatgtcaccatgcccggctaatttttctatttttaatagagacagggtttc  c.897-361

.         .         .         .         .         .           g.25958
accatgttggtctggctagtctcaaactcctgacctcaagtgatccacccaccttggcct  c.897-301

.         .         .         .         .         .           g.26018
cccaaagtgctgggactacaggcgtgagccactgcacccagctgacccttttctttttct  c.897-241

.         .         .         .         .         .           g.26078
ggaaaatatctagtatatgtgtctgaattttcccaatttggcatcattttatgctattta  c.897-181

.         .         .         .         .         .           g.26138
ttagtgggctgttgttacagacagaaaggagttgttaggactcgattagctggatcactc  c.897-121

.         .         .         .         .         .           g.26198
ttgtgttttctttgtacagtttgattttactttaatagctaatgcaaggatctgaattcg  c.897-61

.         .         .         .         .         .           g.26258
gggaattataaacttttgtatcctagcacacttgaattctcttcacttcttctcttgcag  c.897-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center