Hermansky-Pudlak syndrome 5 (HPS5) - 1857 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.26407
gtaattatatttttctttgtaatttttaatctcatgcttatgaaaatttgattattgtag  c.985+60

         .         .         .         .         .         .  g.26467
gagcattctcttgtaatttaagaagttgaaaaataggatgggatgacttttttttttttt  c.985+120

         .         .         .         .         .         .  g.26527
tttttttttttgagactaagtcttgctctgtcacccaggctggagtgcactggtgcgatc  c.985+180

         .         .         .         .         .         .  g.26587
ttggctcacggaaacctccacctcctgggttcaagtgattctcctgcctcagcctcctga  c.985+240

         .         .         .         .         .         .  g.26647
gtagctgggattacaggcacgcaccaccacacctggctaatttttgtatttttagtagag  c.985+300

         .         .         .         .         .         .  g.26707
atggagtttcgccatgttggccaggctggtctcgaattcctgacctcaggtgatctgccg  c.985+360

         .         .         .         .         .         .  g.26767
gcctcagcctcccaaagttctgggattacaaacatgtatgattacaggtgtgagccaccg  c.985+420

         .         .         .         .         .         .  g.26827
tgcccagttacgtttcttttaaagattgaccatagatatttcccattgtaagttacttcc  c.985+480

         .         .         .         .         .         .  g.26887
caaacatgcattagtgaatttgcattcagctatttattttttcatgagtcattttattta  c.985+540

         .         .         .         .         .         .  g.26947
ttttttaattgacacataataattgtacatatttatggggtacataaatatgtaccccat  c.985+600

         .         .         .         .         .         .  g.27007
aatatgtttcgatacatgcagtgtatagtgtaccctgatcagatcagggtggttagcata  c.985+660

         .         .         .         .         .         .  g.27067
tctaccatgttaaacatttattagctcttcatgttgggaacattcattgtccttctagct  c.985+720

         .         .         .         .         .         .  g.27127
ctttgaaaacagacattattattaactatagtcatcctacaatgctatggaacagtagaa  c.985+780

         .         .         .         .         .         .  g.27187
tttattcctcctatctagctataattttgtatcctttaacaagtcttttccctgtcttct  c.985+840

         .         .         .         .         .         .  g.27247
ccttcctcttacccttcccagaatctagtcacctctgttctgcttttttacttctgtgag  c.985+900

         .         .           g.27276
atcacatttttctagcttctgcatataaa  c.985+929

--------------------- middle of intron ---------------------
                     g.27277            .         .           g.27304
                     c.986-928  tgagaacatgtggtctttaactttctgt  c.986-901

.         .         .         .         .         .           g.27364
tcctagcttatttcacttaacatagtgtcttccagttttcatgagtaattttaagtgcag  c.986-841

.         .         .         .         .         .           g.27424
ttttcattagtaactgctgaaaaggaacaaacaggttatttttccctctattgccctgag  c.986-781

.         .         .         .         .         .           g.27484
tctttatccctgccagaagtcttactttgactcccattttgtatctttatagtttggggt  c.986-721

.         .         .         .         .         .           g.27544
tcaaattgttcttgtgggagcaacagccatcatatgtgactgagacagaaaatcaatctc  c.986-661

.         .         .         .         .         .           g.27604
tatattctttgggttaaaaccagaagtgggggaaatctagcttttttaccattgctgctc  c.986-601

.         .         .         .         .         .           g.27664
agtagagagtgttatgttgactttttggttctttttctatgtttgtaaaaaccaaaaaag  c.986-541

.         .         .         .         .         .           g.27724
gagagagagaaagaaatcattacttactggtctcatcaacagtgactttcttgtggctta  c.986-481

.         .         .         .         .         .           g.27784
aatttcttaagtatgtcccttgaaaagtagtcttttaagtcctttcaggatactctgcca  c.986-421

.         .         .         .         .         .           g.27844
agacagatattttcttgaaggcagatattttctcatgaactgtatattgatttacatact  c.986-361

.         .         .         .         .         .           g.27904
atgttaaaatccattcattgaggaccaggttgtaacactcgaaccttatagtctggcctc  c.986-301

.         .         .         .         .         .           g.27964
taatgtagattatcctcttttaatgtcccaattccttttcacagaaaacagcatttttaa  c.986-241

.         .         .         .         .         .           g.28024
acataagactttaggtcagagagatatagttctttcttcacatcttttattcttgatctt  c.986-181

.         .         .         .         .         .           g.28084
tttagaatagtttctaaaatatgatttcttcattgaactgcaagtagaaaaatagagatg  c.986-121

.         .         .         .         .         .           g.28144
aaattcagtcaagccaaaccctacgtaagaaatgaatttattagaataattgcatccctt  c.986-61

.         .         .         .         .         .           g.28204
ttaaaattgtaaggggtatttggttaacattttgtatgttcacacctgtggttttcgtag  c.986-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center