Hermansky-Pudlak syndrome 5 (HPS5) - 574 nt intron 11 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.29676
gtaagtattctcacctttaaaggattttgtagggtaagatttttccatcttcggttgttc  c.1323+60

         .         .         .         .         .         .  g.29736
ttatttacctctaggatccccaaatttgttgtcctttccatttatgttttttggtgggaa  c.1323+120

         .         .         .         .         .         .  g.29796
ggggtgaacttttgttcagctagtggctcagctctgtgaagcctccatttaggtgtgtct  c.1323+180

         .         .         .         .         .         .  g.29856
tggagccacattttgttttgtcattgtttattattttttgttccctgatatactcatata  c.1323+240

         .         .         .         .         g.29903
gctcccagcataagttacgttgctctaatatgtgattttaggtgctt  c.1323+287

--------------------- middle of intron ---------------------
 g.29904            .         .         .         .           g.29950
 c.1324-287  catgctaatttgagcctgaatgcaggtctggattatctcatttaatc  c.1324-241

.         .         .         .         .         .           g.30010
cccattctcactaccaagctttatgaagacaagctagagaaatatggcagctgatgccac  c.1324-181

.         .         .         .         .         .           g.30070
tagcacacggagtgacccagctgccaggcacctaagccttgctcatcagtttgttctaat  c.1324-121

.         .         .         .         .         .           g.30130
aagccataatggttgttattaactttctatttgagtgttggtatttctctgcagaagtta  c.1324-61

.         .         .         .         .         .           g.30190
tattaacgttataaaggaaatttttacctttttttttttttgaattcttttaatttttag  c.1324-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center