Hermansky-Pudlak syndrome 5 (HPS5) - 675 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.30437
gtgatgaatgtgtctgttgttggttcctgatgtgaagccattattttccacgagctcctg  c.1510+60

         .         .         .         .         .         .  g.30497
ttaccaggattatcttgtgcacggaatttctctgaagtgttaataatttttaacatgttg  c.1510+120

         .         .         .         .         .         .  g.30557
atagaactttccatccagatctacagatctgccccctactagaagagttggtttatgttt  c.1510+180

         .         .         .         .         .         .  g.30617
agtattttttcccctcacgtttggactaacattagggcctgtttttgatcatgcatcaaa  c.1510+240

         .         .         .         .         .         .  g.30677
atgctggaaaggttatgaaagaaaggtcattaaccaaaagagtgggaagattttattctg  c.1510+300

         .         .         .          g.30715
actaaccaaattatttttcatcaggattgaaaaattac  c.1510+338

--------------------- middle of intron ---------------------
           g.30716            .         .         .           g.30752
           c.1511-337  tgcagtttttgggggtcattgccttcctttttcgatg  c.1511-301

.         .         .         .         .         .           g.30812
tgcgagtattcctgtggctgaactagtgagaagagaataatagagatcctaaactccctt  c.1511-241

.         .         .         .         .         .           g.30872
tttgacttatggggactcagggttagtaggcaaatgaaggtacctgcctcggtgttttat  c.1511-181

.         .         .         .         .         .           g.30932
gtggaccatcccatgcattttgtaaacctgtgttccactcatttgtttctgggtcagttg  c.1511-121

.         .         .         .         .         .           g.30992
tgattttggtattgaatccttcatttctttcggtttattcatttcagaatttttttaaag  c.1511-61

.         .         .         .         .         .           g.31052
attaaaacaactcccacgtgattagattttgtttctttttttcctgattccattcattag  c.1511-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center