Hermansky-Pudlak syndrome 5 (HPS5) - 829 nt intron 13 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.31236
gtaaaccaattagtcttgtcatttaattccattactgatcttatttcagttctcacatta  c.1634+60

         .         .         .         .         .         .  g.31296
ggtaatttgtgctgagaatggaaaatgagaaaaaggaagtctcttgttttccatataact  c.1634+120

         .         .         .         .         .         .  g.31356
tgtcatatggagctattaacttctcatttaccttggggagagtctagcttccctctgttt  c.1634+180

         .         .         .         .         .         .  g.31416
tagcagctggtatttgagttgttgcagatgtaggtgcccccaccctcaagagatcaaaaa  c.1634+240

         .         .         .         .         .         .  g.31476
ttaaaaatctctgatggtaatagtttccacgtatcattagtctttagctgatcctttcta  c.1634+300

         .         .         .         .         .         .  g.31536
atggtcagtttgggctcagacttggagtcttttcagaattcttttctagctactccatgg  c.1634+360

         .         .         .         .         .       g.31591
gaccagggttgacatttgagtttaagagagaagactttgtgcagctacttaactg  c.1634+415

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.31645
      ctcatctgagtcttactggatacaaattttgcttaagaagggtatattgtgact  c.1635-361

.         .         .         .         .         .           g.31705
agttaacagctgagtttacatgaagcaattctttgttctgtgaccagaatggggctgatg  c.1635-301

.         .         .         .         .         .           g.31765
atcacatggctttgcctaagttgacagaaatattacagatacagctggagttaaagacct  c.1635-241

.         .         .         .         .         .           g.31825
tttctttagcgctgaaacactgatttcttagggcagtttagtaaataatgtgaatcatta  c.1635-181

.         .         .         .         .         .           g.31885
tattgtaagtttatatacgtgaaatactattatttgaacagagaagttgctataaacagt  c.1635-121

.         .         .         .         .         .           g.31945
ctttactaagtccaagttgcctccctaggacttattagggagaaaactgaagaatgaaaa  c.1635-61

.         .         .         .         .         .           g.32005
cctgagttttctcagtaataagtttttattcatgttagttttttgttatttgacttctag  c.1635-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center