Hermansky-Pudlak syndrome 5 (HPS5) - 2043 nt intron 14 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.32215
gtaagcccttacacataaatctctatacattctagggaatccagctgtcagttttaagaa  c.1784+60

         .         .         .         .         .         .  g.32275
agccatagaccaaccttgtgcagcctgtggcccgtgggcctcatgtgttccaggacggct  c.1784+120

         .         .         .         .         .         .  g.32335
ttgaacgtggcccaacacaaatttgtaaagtttctgaaaacatgagtttttttgtgattt  c.1784+180

         .         .         .         .         .         .  g.32395
ttttttttaatagctcatcagctattgttaatgttagtgtattttatgtgtggcccaaga  c.1784+240

         .         .         .         .         .         .  g.32455
caattcttcccatgtggcccggggaagccaaaaattggacacctgtgccatagactatgt  c.1784+300

         .         .         .         .         .         .  g.32515
ccttttcaagaaggcacatgtatgtctgcattcattgaagattgtttgtgtagcttataa  c.1784+360

         .         .         .         .         .         .  g.32575
aaattgtgaaattccacaaagtgttgaaaaattacatcaccccgaagcagatctattgag  c.1784+420

         .         .         .         .         .         .  g.32635
cagagttttaatttagtacttcttccatctttcccctgcataactcccctccttccccca  c.1784+480

         .         .         .         .         .         .  g.32695
taatctcttcaaacttctgggatctcacaggagtattatattaagagtaggatgaccaag  c.1784+540

         .         .         .         .         .         .  g.32755
gatctagacctcatcctggctctgcgtatgactagtatgtgactttgggaatgtcactga  c.1784+600

         .         .         .         .         .         .  g.32815
tgctctctggcctgtaagatccaaaatgtgctattatttgatgagtcaaggactcatcaa  c.1784+660

         .         .         .         .         .         .  g.32875
gcaatagcaaaaggaccaccttttatattatctaattgtctcatgtaacatgagtataat  c.1784+720

         .         .         .         .         .         .  g.32935
actttattctctaataaagagaatattagattgagataatgaaaaagaaaacaagggatt  c.1784+780

         .         .         .         .         .         .  g.32995
ctttaggcaacgttgatcaagcagttggcattgatgtcctatcaggtaccttcccataat  c.1784+840

         .         .         .         .         .         .  g.33055
atgctggtggcctggtccttgtgtagtagagttgtagcagagcccttaattgggcatagt  c.1784+900

         .         .         .         .         .         .  g.33115
gtggagtatcttgtctctctggcttctgccttatagttcagggaatctgggtattaaagg  c.1784+960

         .         .         .         .         .         .  g.33175
caaacaaattcagcacttacccaggaattaagagagaaacccatgggaccagtgcatctg  c.1784+1020

    g.33177
ga  c.1784+1022

--------------------- middle of intron ---------------------
                                              g.33178         g.33178
                                              c.1785-1021  c  c.1785-1021

.         .         .         .         .         .           g.33238
agtcagatgaaataaaagatttgtaatcctcagaataacttagtgaatccatatgtttat  c.1785-961

.         .         .         .         .         .           g.33298
agaaaaaatacagattttttgacatggcatttaatgcagccttctatctgaccttagcta  c.1785-901

.         .         .         .         .         .           g.33358
cctttctagccacatccttctaagtgctataaatttcactcctatcggagaactaagtgt  c.1785-841

.         .         .         .         .         .           g.33418
gtacactgacacttcactacctttcttcatgctatgtcttctatccagagtattctcccg  c.1785-781

.         .         .         .         .         .           g.33478
ccattttttgtgagacaaataatacctccttaggaatatgtccctttccctactcagaaa  c.1785-721

.         .         .         .         .         .           g.33538
aattatttcttcttctctgctttcatatcacaatgctgttttaaagagctgctctttggt  c.1785-661

.         .         .         .         .         .           g.33598
gttcaacttactctttttttaaattatacttagttgtttgcatgcctttctttctaatga  c.1785-601

.         .         .         .         .         .           g.33658
gagcttactggagcttatcaccttgaggccaaggaccaccttttctattcatctatttgt  c.1785-541

.         .         .         .         .         .           g.33718
cttatgtaacatgagtataatacttgccgttagtaagcatgagaaatatttgtccaaggg  c.1785-481

.         .         .         .         .         .           g.33778
tcaggtgcggtggctcacgcactttaggaggccgaggcaggtggatcacgaggtcaggag  c.1785-421

.         .         .         .         .         .           g.33838
atcgggaccattctgactaacatgatgaaaccccatctctactaaaaatacaaaaacaaa  c.1785-361

.         .         .         .         .         .           g.33898
attagccaggcatgatgctgggtgcctgtagtcccagctattcgggaggctgaggcggga  c.1785-301

.         .         .         .         .         .           g.33958
gaatggtgtgaacctgggaggtggagcttgcagtgagcggagatcatgccactgcactcc  c.1785-241

.         .         .         .         .         .           g.34018
agcctaggcaacagagcgtgactctgtctcaaaaaaaaaagaaaaaagaaatatttgtct  c.1785-181

.         .         .         .         .         .           g.34078
aagaaagctctgaggctgaggcagggagaattgcttgaacccgggaggcggaggttgcaa  c.1785-121

.         .         .         .         .         .           g.34138
tgaaccgagatcacgtcactgcactgcagcctgggtgacagagtgagaccctgtctcaaa  c.1785-61

.         .         .         .         .         .           g.34198
aaaagctctgatcccctctaactcttgtgaatgttattgttattttgcacacttttttag  c.1785-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center