Hermansky-Pudlak syndrome 5 (HPS5) - 879 nt intron 15 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.34336
gtgagtataatgagaaacttttatagtgacgtctcaaggcagtttagtaaacgaagtgaa  c.1862+60

         .         .         .         .         .         .  g.34396
tcattatattgtaagttttttatgggccttgtatgaaatatatagttgattagagaagtt  c.1862+120

         .         .         .         .         .         .  g.34456
gctataaatggtctttccttttattaagtccaagttgccttcctaggactaataggaaaa  c.1862+180

         .         .         .         .         .         .  g.34516
acccaggcactgaagttttcattcttggcagcaataagattttcttcatgttaatttttt  c.1862+240

         .         .         .         .         .         .  g.34576
ggtatttgacttccagtattcctagctttgtgtgtaaaactactgagaagattggcagcc  c.1862+300

         .         .         .         .         .         .  g.34636
ttcacacaagcccagaatgggaatgactttctgagtccatcagtagtggtcctgagacag  c.1862+360

         .         .         .         .         .         .  g.34696
tttggggcagagatagcctcatttggaattgaaattgaagaagtaggctgggcgtggtgg  c.1862+420

         .         .  g.34716
ctcatgactgtaatcccagc  c.1862+440

--------------------- middle of intron ---------------------
                             g.34717              .           g.34735
                             c.1863-439  attttgaaaggctgaggtg  c.1863-421

.         .         .         .         .         .           g.34795
ggcggatcgcttgagcttagaagtttgagaccatccagggcaacatgatgaaaccccaaa  c.1863-361

.         .         .         .         .         .           g.34855
taccaaaagtagctgtgtgtagtgggtgtagtggcatgtacctgtattcccagctactca  c.1863-301

.         .         .         .         .         .           g.34915
ggaggctgaggtgggaggatcacttgagcctgcagtgagctatgtttgtgccattgcact  c.1863-241

.         .         .         .         .         .           g.34975
ccagcctgggtgacaaaacaagaccctatctcaaaaaaaaaaaaaaaaaagtaaaacact  c.1863-181

.         .         .         .         .         .           g.35035
acaaagtttatgttctctgttttgtcatcttgttgagatagtttttatttaaagagttga  c.1863-121

.         .         .         .         .         .           g.35095
aaagtaacgtttattccagatgagtatgttacattggttaggttaatttattagcatgaa  c.1863-61

.         .         .         .         .         .           g.35155
ttaatttgttttaagaaaaacacatgacacatgaatttcatacttgtctgtcttgtatag  c.1863-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center