Hermansky-Pudlak syndrome 5 (HPS5) - 3428 nt intron 16 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.35793
gtaatactcagattgccttatcaaagatagaaattcgtattaaaaaacattagcagtttt  c.2440+60

         .         .         .         .         .         .  g.35853
gaattttggggtttaaaaaaaagatttaagtagaaaatcacatctgttctggtcaaccct  c.2440+120

         .         .         .         .         .         .  g.35913
ttattctgttttccattcattttaacttttaatagttctttcagacattggttaaattca  c.2440+180

         .         .         .         .         .         .  g.35973
caactggattataagaaattagtttttaaatttttatttattttattttttttgagacag  c.2440+240

         .         .         .         .         .         .  g.36033
agtttcattctgtttgagtgcagtggcgccatcttggctcactgcaacctccgcctcctg  c.2440+300

         .         .         .         .         .         .  g.36093
ggttcaagtgattgtcttgcctcagcctcccaagtagctgggactgcaggcgtgcaccac  c.2440+360

         .         .         .         .         .         .  g.36153
cacgcccagctaatttttgtattttagtagagacagggttttgccatgtcggccaagctg  c.2440+420

         .         .         .         .         .         .  g.36213
gtctcaaacgcctgacctcaagtgatctacctgccttggcctcccaaagtgttgggatca  c.2440+480

         .         .         .         .         .         .  g.36273
caggcatcaaccactgtgcctggccctattttttatttttagagacagggtctcactctg  c.2440+540

         .         .         .         .         .         .  g.36333
tgcccaggctggaatgcagtggtgtgatcatggctcactgtagccttgatcccttgggtt  c.2440+600

         .         .         .         .         .         .  g.36393
caagcgatcctcctgcctcagttttctgagtcgtgggattacaggcatgtgccactgtac  c.2440+660

         .         .         .         .         .         .  g.36453
cctctgatttcttcatttttttatagagatggggtcttactgtgttgcccaggttggtct  c.2440+720

         .         .         .         .         .         .  g.36513
tgaaatcctgacctcaaagcagtcttcccaccttggcctcccaaaatgctgggattatag  c.2440+780

         .         .         .         .         .         .  g.36573
gtgtgagccaccatgcctggccctagaaattagttttatttctctcataatgacattcag  c.2440+840

         .         .         .         .         .         .  g.36633
aaaatggtagagcagtgctggggaagttgaggttaaagtaaaatgtttataaatgcagat  c.2440+900

         .         .         .         .         .         .  g.36693
gtattaaaagaagaaaatctctcatgtaacttactaatacagaaatactatatggggtac  c.2440+960

         .         .         .         .         .         .  g.36753
ttattgtgtggcagatattatggtaaacacttttcagcattgtctcatttcatccttaca  c.2440+1020

         .         .         .         .         .         .  g.36813
ataatgtttggagtagatggtgttattccattttatagataagcagtctgaggcagagag  c.2440+1080

         .         .         .         .         .         .  g.36873
agatcttaggtagctaaactgctgtaataaatatctgataatgaagtaactcatacataa  c.2440+1140

         .         .         .         .         .         .  g.36933
atagaagtgtatttcttgctcatgtaacagtccaggacaggtattccaggtcagtgggta  c.2440+1200

         .         .         .         .         .         .  g.36993
gctgtctcccaggtggtaattcagcattctagcattccaagttccttccattattttcag  c.2440+1260

         .         .         .         .         .         .  g.37053
ctccatcttcccttaagggatgtggtcatgtttgggttgctatgtctggggaaagcatgt  c.2440+1320

         .         .         .         .         .         .  g.37113
agaaagtgctgtcttataggcctggcctggtagtggcttacctctcttctgtgtacattt  c.2440+1380

         .         .         .         .         .         .  g.37173
ccattgatgagaattctgtcatatagccacaactaactgcaaaggaaactgggaaatgta  c.2440+1440

         .         .         .         .         .         .  g.37233
acctgtccaggaggaaaagaatgaatataggtgaagagctcgcttacatgtctgcctcag  c.2440+1500

         .         .         .         .         .         .  g.37293
agactttggtgcatagcccgcagtatctaccttggcggaaggtcgcatatgtcatcctga  c.2440+1560

         .         .         .         .         .         .  g.37353
catataatagaaaccagctatcataccctaaaaactatatgcattgccctttctgcagcc  c.2440+1620

         .         .         .         .         .         .  g.37413
atagtcccatgtttttgaagaagtgaattttcttaattccaaatcctacttgaataacag  c.2440+1680

         .         .         .      g.37447
atgccatatttctaatactttagactttaagcaa  c.2440+1714

--------------------- middle of intron ---------------------
             g.37448          .         .         .           g.37481
             c.2441-1714  cttttcattcattaccaaaagtgaatagagatac  c.2441-1681

.         .         .         .         .         .           g.37541
atttttatgtcatcttacttaaagatattttagctttctagaaacatggatctatagtta  c.2441-1621

.         .         .         .         .         .           g.37601
cagatctgctttaattcaaatatagcagttaaaagcataataatttttttttttctgagt  c.2441-1561

.         .         .         .         .         .           g.37661
tgaggtagattgtcttttgtgtgaaataagaaacaagctatttctcctcaggtaagttca  c.2441-1501

.         .         .         .         .         .           g.37721
aatgtgtgacattattactcattggaaatttactgtatctgtctctattatgtgatcata  c.2441-1441

.         .         .         .         .         .           g.37781
cccagtcacagaagagcagaaaagagtctccatcagccagagtgatagttgttactacca  c.2441-1381

.         .         .         .         .         .           g.37841
gtgctggctagaggaagcatggtgggcaatttgagtgatatggctgcttacttgaattta  c.2441-1321

.         .         .         .         .         .           g.37901
ggtggatatgtctggtttagctcccgcgcagtcatcaggcttccccaaacctctgaatgg  c.2441-1261

.         .         .         .         .         .           g.37961
cctcctcctctgaattcctttaaagtacttattgcctgacacagtcaaatgggaaacaat  c.2441-1201

.         .         .         .         .         .           g.38021
gagactggggaaaaaatgacttttttaaaaaagcatgtatcagaaaatgaatgttggctc  c.2441-1141

.         .         .         .         .         .           g.38081
ttagaacctggtgagtaggcctcacccttctaatgatgtgataattatgggaaacagctt  c.2441-1081

.         .         .         .         .         .           g.38141
ttggaactgttatttgggatttgtcttcagaggcagttgaaaaatacttgcccagcttag  c.2441-1021

.         .         .         .         .         .           g.38201
gcaacgtagcaagaccccgtctctacacacacaaaaacacacacaccagcctatgcaatg  c.2441-961

.         .         .         .         .         .           g.38261
tagcaagaccctgtctacacacacatacatataaacacacacacacatgccagcctagac  c.2441-901

.         .         .         .         .         .           g.38321
aacgtttcaagaccttgtctctacacacacacacatgcacacacccaggtattgcagcta  c.2441-841

.         .         .         .         .         .           g.38381
ggcaacgtagcaagaccctgtctctccacacacgcatgtgcgcatgtgtgcacacaggca  c.2441-781

.         .         .         .         .         .           g.38441
ctgcagctaggcaacgtaggaagaccccgtcgctgcacacacacacacacacacacacag  c.2441-721

.         .         .         .         .         .           g.38501
ccaggagttcaaggttgcagtgatcaccactgcactccagcctgggcaacagaatgagac  c.2441-661

.         .         .         .         .         .           g.38561
cctgtttctaaaaaactaaaaaagaaaactacttggaaaaaaacccactttactttagat  c.2441-601

.         .         .         .         .         .           g.38621
tcatactttttttttttaaaccacaaatagttttagatcatcactcctttcaccagactt  c.2441-541

.         .         .         .         .         .           g.38681
gattttaagtgacttttggctattccaaaaagtcaaatcttctgttcttcagagaatgag  c.2441-481

.         .         .         .         .         .           g.38741
tatttgctatactggtaactttaaaaaaaggtcaaatattttaaaattaatttcattgaa  c.2441-421

.         .         .         .         .         .           g.38801
tttaattctaaaagatggagtaggaatactagttctagaaaaaactgagcaacttggcat  c.2441-361

.         .         .         .         .         .           g.38861
tgatgatagctatgtatattggtttttgatgtgtgcttatatggacagttgctatatata  c.2441-301

.         .         .         .         .         .           g.38921
ggcctagatactcattattttaagagtaatagtcactgatgtattaattatatgttcctt  c.2441-241

.         .         .         .         .         .           g.38981
cgtcttatttaaaacttttaatatgctttgcctcccaattagattttaaggttcttaaaa  c.2441-181

.         .         .         .         .         .           g.39041
gtagaaattacatctcttgtacttttatttgtttctcttgtaatgcttaatattgggcct  c.2441-121

.         .         .         .         .         .           g.39101
tgcacataataggtccacacagtaggtacgtgactaatgattgctgaatgaacatgttca  c.2441-61

.         .         .         .         .         .           g.39161
taaattgaatatttccgcctaagagataaagtttggaaaaggatatgctttatatttcag  c.2441-1


Powered by LOVD v.3.0 Build 10c
©2004-2014 Leiden University Medical Center